Your browser is out-of-date!

Update your browser to view this website correctly. Update my browser now

×

Discipline
Biological
Keywords
GWAS
Alzheimer’s Disease
Abeta
Tau
Alzgenes
Observation Type
Standalone
Nature
Confirmatory data (published elsewhere)
Submitted
Nov 24th, 2017
Published
May 15th, 2018
  • Abstract

    Alzheimer’s disease (AD) is the most common form of dementia in the elderly. It is a progressive neurodegenerative disorder that is characterized by the abundant presence of cerebral β-amyloid (Aβ) plaques and neurofibrillary Tau tangles. The rare, early-onset AD is caused by mutations mainly within either the amyloid precursor protein (APP) or Presenilins 1 or 2 (PS1 or PS2), the catalytic subunits of the γ-secretase complex. These mutations either increase overall Aβ production or specifically alter γ-secretase mediated processing towards an increased production ratio of Aβ42:Aβ40. For late-onset AD, however, which accounts for the vast majority of AD cases, the exact mechanisms by which the disease is caused are not known. While genome-wide association studies (GWAS) have identified certain genetic risk factors associated with late-onset AD, the mechanisms through which they contribute to the pathogenesis are still elusive. Previously, using a HeLa cell model of Aβ production, it was shown that, in contrast to the early-onset AD causing mutations, knockdown of late-onset AD susceptibility genes did not specifically affect the Aβ42:Aβ40 ratio. To validate these findings in a neuronal setting without any overexpression of APP, here we re-addressed the role of 6 late-onset AD risk genes (APOE, BIN1, PICALM, CLU, PRNP and CST3) in the regulation of γ-secretase mediated APP processing in wild-type mouse primary neurons by analyzing Aβx-40 and Aβx-42. In addition, we extended the analysis by also including measurements of total Tau protein and phosphorylation of Tau at Threonine 231, a non-physiological phosphorylation site that is associated with AD. The siRNA-mediated knockdown of the studied LOAD risk genes neither affected the Aβx-42:Aβx-40 ratio nor altered the levels of total Tau or phospho(Thr231)-Tau. Our results thus show that acute downregulation of these genes in wild-type mouse primary neurons does not significantly impact on γ-secretase mediated APP processing nor Tau homeostasis or Tau phosphorylation.

  • Figure
  • Introduction

    The brains of Alzheimer’s disease (AD) patients show widespread formation of extracellular senile plaques composed of aggregated β-amyloid (Aβ) peptides as well as intraneuronal aggregates of misfolded Tau protein, so-called neurofibrillary tangles. According to the onset of disease one can distinguish two types of AD: a rare, early-onset AD (EOAD) with an onset before 65 years of age, and the common, late-onset AD (LOAD) with an onset after 65 years of age. EOAD is caused by a specific set of highly penetrant mutations, which affect almost exclusively either the amyloid precursor protein (APP) or the catalytically active Presenilin subunit of the Aβ-producing γ-secretase complex. These mutations enhance the overall production of Aβ peptides and/or increase the ratio of the aggregation prone and neurotoxic Aβ42 over the common, shorter Aβ40. The genetic contribution to LOAD, on the other hand, is not very well understood. Inheritance patterns within families point to multifactorial inheritance of LOAD, involving both genetic and environmental factors. Initial linkage analysis studies and GWAS analyses have identified a number of susceptibility genes for LOAD (Alzgenes), the majority of which having only small effect sizes on disease risk. The only exception is the APOE ɛ4 locus which increases LOAD risk 2- to 4-fold in individuals with one copy of the allele and 8- to 15-fold in individuals carrying two copies.

    While an increased production of Aβ and/or an increased Aβ 42:40 ratio have been acknowledged as the driving pathogenic mechanism in EOAD, the etiology of LOAD appears to be much more complex and it is still not absolutely clear if Aβ accumulation plays an active causative role in the initial pathogenesis of the disease. Also the mechanisms that drive Aβ accumulation appear to be different in LOAD and EOAD. While some studies showed effects of LOAD risk genes on Aβ production, most of the data suggest that Aβ accumulation in the brains of LOAD patients results from impaired Aβ clearance rather than an increased production as seen in EOAD. For example APOE, which is the strongest genetic risk factor for LOAD, was shown to bind to Aβ and mediate its clearance across the blood brain barrier (BBB) or its endocytosis into brain cells for lysosomal degradation. Similarly, also CLU and PICALM had been shown to enhance the transport of Aβ across the blood-brain barrier and the blood-cerebrospinal fluid barrier. In line with the notion that LOAD genes do not specifically affect Aβ production, a recent study did not detect specific effects of the knockdowns of several LOAD susceptibility genes on Aβ levels or the 42:40 ratio in a HeLa cell APP overexpression system.

  • Objective

    We wanted to study the effect of acute downregulation of selected LOAD risk genes on γ-secretase mediated processing of endogenous APP and on levels of endogenous total Tau and phospho-Tau (pThr231) in wild-type neurons. The selected risk genes comprised four high ranking Alzgenes (Apolipoprotein E [APOE], Bridging integrator 1 [BIN1], Phosphatidylinositol binding clathrin assembly protein [PICALM], Clusterin [CLU] and two LOAD risk genes with weaker association (Prion protein [PRNP] and Cystatin C [CST3]).

  • Results & Discussion

    In order to study the role of selected LOAD risk genes on γ-secretase mediated processing of endogenous APP and on levels of endogenous total Tau and phospho-Tau in neurons, we performed individual siRNA-mediated gene knockdowns in primary neuronal cultures prepared from embryonic wildtype mice. We chose a set of 4 high ranking Alzgenes (APOE, BIN1, CLU, PICALM) and 2 risk genes with weaker association (PRNP and CST3) which were readily detectable at mRNA level in the primary cultures and amenable to gene knockdown by RNAi. As negative control, we transfected a pool of non-targeting siRNAs. In addition, we chose four non-AD control genes (TARDBP: TAR-DNA-binding protein 43, RELN: Reelin, KAT5: Lysine acetyltransferase 5 and SNCA: α-synuclein) that are implicated in other neurodegenerative diseases and neurological conditions including amyotrophic lateral sclerosis (ALS), frontotemporal lobar degeneration (FTD), schizophrenia, autism, multiple sclerosis (MS) and Parkinson’s disease (PD). As positive controls, we transfected siRNAs that target either APP or MAPT. Knockdown-efficiencies of all candidate and control genes were assessed at the mRNA level by real-time PCR in each experimental round. In addition, knockdown of candidate genes at the protein level were confirmed by Western Blot analysis. For the simultaneous detection of both Aβx-40 and Aβx-42 or phospho(Thr231)-Tau and total Tau, we used specific multiplex electrochemiluminescence assays for analysis of the conditioned neuronal culture medium or the recovered protein fraction of the whole cell lysate respectively. Knockdown of the positive control APP led to the expected reduction of both Aβx-40 and Aβx-42 without altering Tau levels (Fig. 1A) while transfection of MAPT siRNA significantly lowered the signal of total and phospho (Thr231)-Tau without affecting Aβ (Fig. 1B), thus proving the functionality of the RNAi approach and the validity of the assays.

    Silencing any of the tested Alzgenes did not affect secreted Aβx-40 and Aβx-42 or the Aβx-42:Aβx-40 ratio (Fig. 1A) nor did it alter total Tau and phospho(Thr231)-Tau levels (Fig.1B). Our results suggest that, in wildtype mouse primary cortical/hippocampal neurons, acute knockdown of the studied LOAD risk genes does not crucially impact on γ-secretase mediated APP processing nor on total Tau levels or Tau(Thr231)-phosphorylation. Susceptibility to AD through these genes might involve effects on APP processing or Tau that build up only over a longer time or only at a later stage, when neurons have already undergone substantial aging. Alternatively, these genes might play a role in mediating Aβ toxicity to neurons, or alter Aβ clearance pathways by non-neuronal cell types, or modulate Aβ aggregation. Indeed, experimental evidence for multiple of these possible mechanisms have been provided by previous studies for several of the herein studied susceptibility genes. For example, in addition to the aforementioned roles of APOE, CLU and PICALM in facilitating Aβ clearance, APOE lipoproteins were shown to regulate the association of oligomeric Aβ with synapses, CLU and CST3 were shown to inhibit Aβ aggregation and PRNP was shown to play a role in mediating the deleterious effects of Aβ on synaptic transmission and learning and memory, though this finding was challenged by at least 3 other groups. Importantly, while in our study the knockdown of the tested genes in mouse primary neurons altered neither Aβx-40 and Aβx-42 nor total Tau and phospho(Thr231)-Tau levels, a number of previous studies using different systems reported effects on Aβ or Tau pathology for some of the tested genes. APOE, for example, was shown to regulate neuronal Aβ production by modulating APP recycling or APP transcription when applied extracellularly. It is conceivable that the reason why we did not observe any effects of APOE knockdown on Aβx-40 and Aβx-42 is because it is expressed mainly by astrocytes and produced only at low amounts by primary neuronal cultures as used for our study. For BIN1, conflicting results have been reported on its role in Aβ regulation: while depletion of BIN1 in neurons resulted in a slight decrease in secreted Aβ40 with a concomitant increase in intracellular Aβ40 and Aβ42 in one study, increased levels of secreted Aβ were observed by another group and no effects were detected in neuroblastoma cells in a third study. Similarly, also for PICALM the observed effects on Aβ are diverging: in one study, PICALM was reported to promote Aβ generation in cells and to accelerate Aβ pathology in APP transgenic mice whereas another study observed no effect on cellular Aβ production. As for PRNP, a direct role was proposed in the regulation of Aβ production through inhibition of β-secretase-mediated cleavage of APP. In our study, neither Aβx-40 nor Aβx-42 levels changed upon knockdown of BIN1, PICALM or PRNP in mouse primary neurons. Our results thus suggest that the overall APP processing by γ-secretase is not altered by downregulation of either of these genes in young cultured wild-type neurons. Since the assay used in our analysis was chosen so as to detect all Aβx-40 and Aβx-42 species produced by γ-secretase, comprising full-length Aβ and the shorter Aβ' and p3 peptides, our data do not necessarily challenge earlier findings on altered full length Aβ levels. Regarding Tau pathology, only for BIN1 a link has been reported previously: BIN1 expression was shown to correlate with the amount of neurofibrillary tangles (NFT) or total-Tau/phospho-Tau in AD patients in 2 studies and a direct interaction between BIN1 and Tau was suggested by another. However, no significant overlap between BIN1 and neurofibrillary tangles was seen in a more recent study. Previously reported effects of experimentally altered BIN1 expression on Tau pathology have been controversial too. While loss of BIN1 was shown to reduce Tau mediated neurodegeneration in Drosophila, it reduced the propagation of Tau pathology in an in vitro system. We did not observe a significant effect of BIN1 downregulation on wildtype total Tau or pTau(Thr231) levels in our study. Effects on Tau pathology progression as seen in the earlier studies might possibly require a disease context as provided by the presence of Tau mutations in these studies.

  • Conclusions

    Our results show that acute downregulation of the studied LOAD risk genes in mouse primary neurons does not significantly alter γ-secretase mediated APP processing, Tau levels or Tau(Thr231)-phosphorylation. Susceptibility to AD through these genes might be conferred through other mechanisms, for example modulation of Aβ clearance or Aβ aggregation/toxicity as it has been proposed by some of the studies discussed above and/or Aβ and Tau-independent signaling pathways that directly affect neuronal function.

  • Limitations

    There are 3 important limitations to our study:

    1. The in vitro character of the study: The simple intercellular connections that are formed in a primary neuronal culture do not allow to model the complex interactions that occur in an intact brain. Any effects that depend on the network activity within or between certain brain areas can therefore not be assessed by our model.

    2. The limited time frame during which we assessed the role of the studied Alzgenes: Knockdowns were performed for about 72 h. Any effects on APP processing or Tau that build up only over a longer period, as it might be the case in AD, would not be detected in our system.

    3. The age of the primary neurons: Primary neuronal cultures were prepared from embryonic neurons, thus neurons in their very early developmental stage. LOAD, however, is a disease of the aged brain. The expression profiles of the tested Alzgenes and their interaction partners might be very different in young and old neurons.

  • Conjectures

    We are now planning to study the role of the respective risk gene variants in neurons derived from human induced pluripotent stem cells (iPSCs) which have been modified using CRISPR/Cas9 technology for targeted genome editing to introduce the respective LOAD associated genetic polymorphisms. This will not only allow us to assess long-term effects of the respective risk variants on APP processing and Tau homeostasis but also to test whether these genes would have any roles in neuronal physiology and function in an Aβ and Tau independent manner.

  • Methods

    Mouse primary neuronal cultures

    Mixed cortical/hippocampal primary neuronal cultures were prepared from E16 ICR (CD-1®) outbred mice (Harlan Laboratories, Horst, Netherlands). Cortices with adjacent hippocampi were dissected in ice-cold HBSS, incubated in 7 ml TrypLe Express for 10 min at 37°C and triturated in Dulbecco’s modified Eagle’s medium (DMEM) (1 g/l glucose) containing 5% FCS (all from Life Technologies) through repeated pipetting with a 5 ml serological pipette and then passed through a 70 µM cell strainer. Neurons were cultured in Neurobasal medium supplemented with B27 (1:50) and 1 mM GlutaMax (all from Life Technologies, Zug, Switzerland) on 96-well plates coated with poly-D-lysine (Sigma Aldrich, St. Gallen, Switzerland) in a humidified incubator at 37°C in a 5% (vol/vol) CO2 atmosphere.

    siRNA transfection

    4DIV primary neurons were transfected with 50 nM of siRNA (stealth siRNA, Life Technologies, Zug, Switzerland) using Lipofectamine RNAiMax (Life Technologies, Zug, Switzerland) as transfection reagent. For each gene, a pool of 4 different siRNA duplexes was used. A pool of 3 different non-targeting siRNAs served as negative control. For each well of a 96-well plate 0.4 µl of RNAiMax were mixed with siRNA and Neurobasal (Life Technologies, Zug, Switzerland) in a final volume of 20 µl. The mix was incubated for 25 min at RT and then further diluted with Neurobasal medium to 100 µl. Cells were incubated with the transfection mix for 6 h, after which the medium on the cells was again replaced with Neurobasal medium supplemented with B27 (1:50) and 1 mM GlutaMax (all from Life Technologies, Zug, Switzerland).

    siRNAs

    negative controls

    medGC duplex #1 Life Technologies #12935-111

    medGC duplex #2 Life Technologies #12935-112

    medGC duplex #3 Life Technologies #12935-113

    APP

    Sense sequence 1 GCGGAUGGAUGUUUGUGAGACCCAU

    Sense sequence 2 UCAGGAUUUGAAGUCCGCCAUCAAA

    Sense sequence 3 GACCAGGUUCUGGGCUGACAAACAU

    Sense sequence 4 CACACACCCACAUCGUGAUUCCUUA

    APOE

    Sense sequence 1 GGUUCGAGCCAAUAGUGGAAGACAU

    Sense sequence 2 GCAGAGCUCCCAAGUCACACAAGAA

    Sense sequence 3 GAUGGAGGAACAGACCCAGCAAAUA

    Sense sequence 4 GAGAAUCAAUGAGUAUCCUUCUCCU

    BIN1

    Sense sequence 1 CCUGGCAGGGAUGAAGCAAACAAGA

    Sense sequence 2 UCGGACCUAUCUGGCUUCUGUUAAA

    Sense sequence 3 GAUGACGCAUUUGUCCCUGAGAUCA

    Sense sequence 4 AAGAGAUGAGUAAGCUCAAUCAGAA

    CLU

    Sense sequence 1 UCUCUGACAAUGAGCUCCAAGAACU

    Sense sequence 2 UGUACUUGAGCAGAGCGCUAUAAAU

    Sense sequence 3 ACGCCAUGAAGAUUCUCCUGCUGUG

    Sense sequence 4 CCACUCAAGGGAGUAGGUAUAUUAA

    PICALM

    Sense sequence 1 GGGAGAUCCUUUCUCUGCUACUCUA

    Sense sequence 2 GCUUGACUUGCAGCAGCCAACCUUU

    Sense sequence 3 UGGCUCCGCGGUAUCUAAGACAGUA

    Sense sequence 4 CAGCAGUCUUCUUGAUGCUUUAGAA

    PRNP

    Sense sequence 1 GGGACAACCUCAUGGUGGUAGUUGG

    Sense sequence 2 CCAGUGGAUCAGUACAGCAACCAGA

    Sense sequence 3 UGGAGCAGAUGUGCGUCACCCAGUA

    Sense sequence 4 CACGACUGCGUCAAUAUCACCAUCA

    CST3

    Sense sequence 1 CCAGACAAAUUUGACUGACUGUCCU

    Sense sequence 2 AGGCACUCUGCUCCUUCCAGAUCUA

    Sense sequence 3 GACUUCGCUGUGAGCGAGUACAACA

    Sense sequence 4 CAGCUCGUGGCUGGAGUGAACUAUU

    MAPT

    Sense sequence 1 CAGGAGGUGGCCAGGUGGAAGUAAA

    Sense sequence 2 CAGGAGGUGGCAAGGUGCAGAUAAU

    Sense sequence 3 CAGUCGAAGAUUGGCUCCUUGGAUA

    Sense sequence 4 CAAGACAGACCAUGGAGCAGAAAUU

    TARDBP

    Sense sequence 1 GCAAUCUGGUAUAUGUUGUCAACUA

    Sense sequence 2 CGAAAGGGUUUGGCUUUGUUCGAUU

    Sense sequence 3 GAAAUACCAUCAGAAGACGAUGGGA

    Sense sequence 4 CCUCCCUGUUGAGUGAGGCUAUUUA

    RELN

    Sense sequence 1 GCUCUCAAACUGGAUUUCAAGAUAA

    Sense sequence 2 CCUGGGUGAUCGACCAGAUUCUUAU

    Sense sequence 3 GAGAGCUCAUUAUACAGCCAGGAUA

    Sense sequence 4 CAGUUCCAUGAAGCCACCAUUUAUA

    KAT5

    Sense sequence 1 AGCCUGGACGGAAGCGGAAAUCUAA

    Sense sequence 2 CGGCACCCUCCAGGCAAUGAAAUUU

    Sense sequence 3 CGUAAUGACGGAGUAUGACUGCAAA

    Sense sequence 4 CACACUGCAGUAUCUCAACCUCAU

    SNCA

    Sense sequence 1 GCAAGUGACAAAUGUUGGAGGAGCA

    Sense sequence 2 GGGAGUCCUCUAUGUAGGUUCCAAA

    Sense sequence 3 CCAAGACUAUGAGCCUGAAGCCUAA

    Sense sequence 4 CACAGGAAGGAAUCCUGGAAGACAU

    Alamar Blue assay

    Alamar Blue metabolisation was used as an indirect measure of cell number and viability of primary neurons. Alamar BlueTM assay reagent (AbD Serotec Ltd, Bio-Rad, Cressier, Switzerland) was added to the cells at a final concentration of 10% for the final 3 h before termination of the medium collection period. Levels of the metabolite resofurin were assessed by 544EX nm/590EM nm fluorescence measurements with the Spectra MAX-GEMINI-XS spectrofluorometer (Molecular-Devices, Sunnyvale, CA, USA).

    RNA isolation

    For RNA extraction, adherent neurons were briefly washed with PBS (containing CaCl2 and MgCl2) and lysed in 100 µl TRI-Reagent (Sigma-Aldrich, Buchs, Switzerland) per well. Lysates of technical replicates of each experimental condition were pooled and isolation of RNA was performed according to manufacturer's instructions. All RNA samples were subjected to DNase treatment using 0.5 units of DNaseI (Fermentas; Life Technologies, Zug, Switzerland) for 30 min at 37°C. DNase was heat inactivated by a 10 min incubation at 65°C in the presence of 5 mM EDTA. RNA concentrations were measured with a Nanodrop 2000 UV-Vis spectrophotometer (Thermo Scientific, Waltham, MA, USA).

    Protein isolation

    Protein was recovered from the organic/phenol phase that was obtained during RNA isolation with TRI-Reagent (Sigma-Aldrich, Buchs, Switzerland) following the manufacturer’s protocol for protein precipitation with acetone. The obtained protein pellet was resuspended in 9.5 M Urea (pH 9.0), 2% CHAPS. For analysis by electrochemiluminescence multiplex assay, samples were diluted 1:100 with TBS (pH 7.5) containing 0.05% Tween and 1% BlockerA (Meso Scale Discovery).

    cDNA synthesis

    For each sample 500 ng of total RNA was reverse-transcribed using the iScript cDNA-Synthesis-kit (Bio-Rad, Cressier, Switzerland) according to manufacturer’s instructions.

    Real-time PCR

    Real-time PCR for relative quantification of cDNA levels was performed with the 7900HT Real-Time PCR System (Life-Technologies, Zug, Switzerland), using the iTaq-SybrGreen Supermix with ROX (Bio-Rad, Cressier, Switzerland). Relative gene expression levels were calculated with the ΔΔCt-method using GAPDH for normalization.

    Real-time PCR primer

    GAPDH

    Forward primer ATCACTGCCACCCAGAAGAC

    Reverse primer GGATGCAGGGATGATGTTCT

    APP

    Forward primer ACCGTTGCCTAGTTGGTGAGT

    Reverse primer CGGTGTGCCAGTGAAGATG

    APOE

    Forward primer CTGAACCGCTTCTGGGATTAC

    Reverse primer CCATCAGTGCCGTCAGTTCT

    BIN1

    Forward primer GAAGATCGCCAGCAACGTAC

    Reverse primer TGCTCAAACTGCTCGTCCTT

    CLU

    Forward primer CGTCCAGGGAGTGAAGCA

    Reverse primer AATCCCTAGTGTCCTCCAGAGC

    PICALM

    Forward primer AAGGTTGCACCAACAACTGC

    Reverse primer CTATCATGCCCGTTGGTGTAGT

    PRNP

    Forward primer TCCATTTTGGCAACGACTG

    Reverse primer TCGTGCACGAAGTTGTTCTG

    CST3

    Forward primer TACAACAAGGGCAGCAACG

    Reverse primer TAGTTCGGCCCATCTCCAC

    MAPT

    Forward primer TCGCCAGGAGTTTGACACA

    Reverse primer GTCTCCGATGCCTGCTTCT

    TARDBP

    Forward primer GAAGACGATGGGACGGTGT

    Reverse primer TCCACCAGTCGGACTCCTC

    RELN

    Forward primer CAAGGTGACGACTGCTCTGTC

    Reverse primer ACTCCACCCTGGATGGTTTC

    KAT5

    Forward primer CCTGTGTCTTCTGGCCAAGT

    Reverse primer CCCACGATGTGGAAACCTT

    SNCA

    Forward primer ATGTTGGAGGAGCAGTGGTG

    Reverse primer GCCCATCTGGTCCTTCT

    Electrochemiluminescence assay

    x-40 and Aβx-42 levels in 24 h conditioned medium of 8DIV mouse primary neurons were analyzed with the Aβ-Panel1 (4G8) Kit (Meso Scale Discovery, Maryland, USA) following the manufacturer’s instructions. To each well of a 96-well assay plate 25 µl of 1:50 diluted Sulfo-Tag 4G8 mAb detection antibody and 25 µl of conditioned medium were added and incubated overnight at 4°C. Total Tau and phosphoThr231-Tau from 8DIV mouse primary neuronal cultures were assayed in the recovered protein fraction with the Phospho(Thr231)/Total Tau Kit (Meso Scale Discovery, Maryland, USA) following the manufacturer’s instructions. To each well of a 96-well assay plate 25 µl of sample were added and incubated for 2 h at RT on a shaker at 750 rpm. Incubation with the detection antibody was for 1 h at RT on a shaker at 750 rpm using 25 µl of Sulfo-Tag anti-Tau antibody per well at a concentration of 1 µg/ml. Measurements were taken on a Sector-Imager-6000 (Meso-Scale-Discovery, Maryland, USA). Electrochemiluminescence values were normalized to the corresponding Alamar-Blue assay values.

    SDS-PAGE and Western blot

    Proteins were separated on 4–12% Bis-Tris gels (Life Technologies, Zug, Switzerland) and blotted on 0.2µm Nitrocellulose membranes (Life Technologies, Zug, Switzerland). Unspecific binding was blocked by preincubation of membranes with TBS-Tween(0.05%) containing 5% w/v nonfat milk powder. Incubation with primary antibodies was performed overnight at 4°C, incubation with secondary antibodies for 1 h at room temperature. Infrared signal at 700 nm and 800 nm were acquired with an Odyssey CLx Imaging System (Li-COR Biosciences, Bad Homburg, Germany).

    Primary antibodies

    goat anti-ApoE (Santa Cruz # sc-6384) 1:100

    rabbit anti-Bin1 (Proteintech # 14647-1-AP) 1:1000

    goat anti-ApoJ/Clu (Abcam # ab79280) 1:500

    rabbit anti-Picalm (Abcam # ab106409) 1:500

    mouse anti-PrnP (Abcam # ab61409) 1:500

    rabbit anti-Cst3 (Proteintech # 12245-1-AP) 1:1000

    mouse anti-β-Actin (Abcam # ab6276) 1:10000

    mouse anti-Gapdh (Life Technologies # AM4300) 1:5000

    Secondary antibodies

    donkey anti-mouse IRDye 800CW (Li-COR Biosciences # 926-32212) 1:5000

    donkey anti-rabbit IRDye 800CW (Li-COR Biosciences # 926-32213) 1:5000

    donkey anti-goat IRDye 800CW (Li-COR Biosciences # 926-32214) 1:5000

    donkey anti-mouse IRDye 680RD (Li-COR Biosciences # 926-68072) 1:5000

  • Funding statement

    L. R. was supported by the Swiss National Science Foundation grants (Sinergia and Core Interdisciplinary grants), by the Velux Foundation, the Novartis Foundation grant, the Cure Alzheimer Foundation, the Hurka Stiftung, the Bangerter Stiftung, the Baugarten Stiftung and the Synapsis Foundation. G. S. was supported by an EMBO long-term fellowship (ALTF 668-2011) and the University of Zurich’s Forschungskredit (K-82033-02-01).

  • Acknowledgements

    We thank the lab members for their stimulating discussions.

  • Ethics statement

    All animal experiments were done according to the guidelines of and approved by the veterinary office of the Canton of Zürich, Switzerland.

  • References
  • 1
    Lorem ipsum Lorem ipsum Lorem ipsum Lorem ipsum Lorem ipsum Lorem ipsum Lorem ipsum Lorem ipsum

    Lorem ipsum Lorem ipsum Lorem ipsum Lorem ipsum ipsum Lorem ipsum Lorem ipsum Lorem ipsum Lorem ipsum ipsum

    Lorem ipsum Lorem ipsum Lorem ipsum
    2
    Lorem ipsum Lorem ipsum Lorem ipsum Lorem ipsum Lorem ipsum Lorem ipsum Lorem ipsum Lorem ipsum

    Lorem ipsum Lorem ipsum Lorem ipsum Lorem ipsum ipsum Lorem ipsum Lorem ipsum Lorem ipsum Lorem ipsum ipsum

    Lorem ipsum Lorem ipsum Lorem ipsum
    3
    Lorem ipsum Lorem ipsum Lorem ipsum Lorem ipsum Lorem ipsum Lorem ipsum Lorem ipsum Lorem ipsum

    Lorem ipsum Lorem ipsum Lorem ipsum Lorem ipsum ipsum Lorem ipsum Lorem ipsum Lorem ipsum Lorem ipsum ipsum

    Lorem ipsum Lorem ipsum Lorem ipsum
    4
    Lorem ipsum Lorem ipsum Lorem ipsum Lorem ipsum Lorem ipsum Lorem ipsum Lorem ipsum Lorem ipsum

    Lorem ipsum Lorem ipsum Lorem ipsum Lorem ipsum ipsum Lorem ipsum Lorem ipsum Lorem ipsum Lorem ipsum ipsum

    Lorem ipsum Lorem ipsum Lorem ipsum
    5
    Lorem ipsum Lorem ipsum Lorem ipsum Lorem ipsum Lorem ipsum Lorem ipsum Lorem ipsum Lorem ipsum

    Lorem ipsum Lorem ipsum Lorem ipsum Lorem ipsum ipsum Lorem ipsum Lorem ipsum Lorem ipsum Lorem ipsum ipsum

    Lorem ipsum Lorem ipsum Lorem ipsum
    Matters11.5/20

    Analysis of Aβx-42/Aβx-40 and Tau upon siRNA-mediated downregulation of APOE, BIN1, PICALM, CLU, PRNP and CST3 in wildtype mouse primary neurons

    Affiliation listing not available.
    Abstractlink

    Alzheimer’s disease (AD) is the most common form of dementia in the elderly. It is a progressive neurodegenerative disorder that is characterized by the abundant presence of cerebral β-amyloid (Aβ) plaques and neurofibrillary Tau tangles. The rare, early-onset AD is caused by mutations mainly within either the amyloid precursor protein (APP) or Presenilins 1 or 2 (PS1 or PS2), the catalytic subunits of the γ-secretase complex. These mutations either increase overall Aβ production or specifically alter γ-secretase mediated processing towards an increased production ratio of Aβ42:Aβ40. For late-onset AD, however, which accounts for the vast majority of AD cases, the exact mechanisms by which the disease is caused are not known. While genome-wide association studies (GWAS) have identified certain genetic risk factors associated with late-onset AD, the mechanisms through which they contribute to the pathogenesis are still elusive. Previously, using a HeLa cell model of Aβ production, it was shown that, in contrast to the early-onset AD causing mutations, knockdown of late-onset AD susceptibility genes did not specifically affect the Aβ42:Aβ40 ratio[1]. To validate these findings in a neuronal setting without any overexpression of APP, here we re-addressed the role of 6 late-onset AD risk genes (APOE, BIN1, PICALM, CLU, PRNP and CST3) in the regulation of γ-secretase mediated APP processing in wild-type mouse primary neurons by analyzing Aβx-40 and Aβx-42. In addition, we extended the analysis by also including measurements of total Tau protein and phosphorylation of Tau at Threonine 231, a non-physiological phosphorylation site that is associated with AD. The siRNA-mediated knockdown of the studied LOAD risk genes neither affected the Aβx-42:Aβx-40 ratio nor altered the levels of total Tau or phospho(Thr231)-Tau. Our results thus show that acute downregulation of these genes in wild-type mouse primary neurons does not significantly impact on γ-secretase mediated APP processing nor Tau homeostasis or Tau phosphorylation.

    Figurelink

    Figure 1. Knockdown of APOE, BIN1, CLU, PICALM, PRNP or CST3 in wildtype mouse primary neurons does not alter levels of secreted Aβx-40 and Aβx-42 nor levels of total Tau and phospho(Thr231)-Tau.

    4DIV wild-type mouse primary neurons were transfected with the indicated siRNAs and cultured until 8DIV. Levels of secreted Aβx-40 and Aβx-42 and levels of total Tau and phosphoThr231-Tau were measured by an electrochemiluminescence (ECL) assay.

    (A) Left panel: Analysis of relative Aβx-40 and Aβx-42 levels in 24 h conditioned medium that was collected from 7DIV until 8DIV. Results are displayed as average ± STDEV (n=3). Statistical significance was calculated by student’s t-test for comparison of each experimental condition to the control siRNA condition (***p <0.001). Right panel: mRNA knockdown efficiencies as analyzed by real-time PCR.

    (B) Left panel: Analysis of relative levels of total Tau and phosphoThr231-Tau in the protein fraction of whole cell lysates from 8DIV neuronal cultures. Results are displayed as average ± STDEV (n=3). Statistical significance was calculated by student’s t-test for comparison of each experimental condition to the control siRNA condition (***p <0.001). Right panel: mRNA knockdown efficiencies as analyzed by real-time PCR.

    (C) Representative Western Blots for analysis of knockdown efficiency on protein level for the tested LOAD risk genes. APOE, BIN1, CLU, PICALM and PRNP levels were analyzed from cell lysates. CST3 levels were analyzed from 24 h conditioned medium.

    Introductionlink

    The brains of Alzheimer’s disease (AD) patients show widespread formation of extracellular senile plaques composed of aggregated β-amyloid (Aβ) peptides as well as intraneuronal aggregates of misfolded Tau protein, so-called neurofibrillary tangles. According to the onset of disease one can distinguish two types of AD: a rare, early-onset AD (EOAD) with an onset before 65 years of age, and the common, late-onset AD (LOAD) with an onset after 65 years of age. EOAD is caused by a specific set of highly penetrant mutations, which affect almost exclusively either the amyloid precursor protein (APP) or the catalytically active Presenilin subunit of the Aβ-producing γ-secretase complex. These mutations enhance the overall production of Aβ peptides and/or increase the ratio of the aggregation prone and neurotoxic Aβ42 over the common, shorter Aβ40. The genetic contribution to LOAD, on the other hand, is not very well understood. Inheritance patterns within families point to multifactorial inheritance of LOAD, involving both genetic and environmental factors. Initial linkage analysis studies and GWAS analyses have identified a number of susceptibility genes for LOAD (Alzgenes), the majority of which having only small effect sizes on disease risk[2]. The only exception is the APOE ɛ4 locus which increases LOAD risk 2- to 4-fold in individuals with one copy of the allele and 8- to 15-fold in individuals carrying two copies[3][4][5][6][7].

    While an increased production of Aβ and/or an increased Aβ 42:40 ratio have been acknowledged as the driving pathogenic mechanism in EOAD, the etiology of LOAD appears to be much more complex and it is still not absolutely clear if Aβ accumulation plays an active causative role in the initial pathogenesis of the disease. Also the mechanisms that drive Aβ accumulation appear to be different in LOAD and EOAD. While some studies showed effects of LOAD risk genes on Aβ production, most of the data suggest that Aβ accumulation in the brains of LOAD patients results from impaired Aβ clearance rather than an increased production as seen in EOAD[8][9]. For example APOE, which is the strongest genetic risk factor for LOAD, was shown to bind to Aβ and mediate its clearance across the blood brain barrier (BBB) or its endocytosis into brain cells for lysosomal degradation[10][11]. Similarly, also CLU and PICALM had been shown to enhance the transport of Aβ across the blood-brain barrier and the blood-cerebrospinal fluid barrier[12][13][14][15]. In line with the notion that LOAD genes do not specifically affect Aβ production, a recent study did not detect specific effects of the knockdowns of several LOAD susceptibility genes on Aβ levels or the 42:40 ratio in a HeLa cell APP overexpression system[1].

    Objectivelink

    We wanted to study the effect of acute downregulation of selected LOAD risk genes on γ-secretase mediated processing of endogenous APP and on levels of endogenous total Tau and phospho-Tau (pThr231) in wild-type neurons. The selected risk genes comprised four high ranking Alzgenes (Apolipoprotein E [APOE], Bridging integrator 1 [BIN1], Phosphatidylinositol binding clathrin assembly protein [PICALM], Clusterin [CLU] and two LOAD risk genes with weaker association (Prion protein [PRNP] and Cystatin C [CST3]).

    Results & Discussionlink

    In order to study the role of selected LOAD risk genes on γ-secretase mediated processing of endogenous APP and on levels of endogenous total Tau and phospho-Tau in neurons, we performed individual siRNA-mediated gene knockdowns in primary neuronal cultures prepared from embryonic wildtype mice. We chose a set of 4 high ranking Alzgenes (APOE, BIN1, CLU, PICALM) and 2 risk genes with weaker association (PRNP and CST3) which were readily detectable at mRNA level in the primary cultures and amenable to gene knockdown by RNAi. As negative control, we transfected a pool of non-targeting siRNAs. In addition, we chose four non-AD control genes (TARDBP: TAR-DNA-binding protein 43, RELN: Reelin, KAT5: Lysine acetyltransferase 5 and SNCA: α-synuclein) that are implicated in other neurodegenerative diseases and neurological conditions including amyotrophic lateral sclerosis (ALS), frontotemporal lobar degeneration (FTD), schizophrenia, autism, multiple sclerosis (MS) and Parkinson’s disease (PD). As positive controls, we transfected siRNAs that target either APP or MAPT. Knockdown-efficiencies of all candidate and control genes were assessed at the mRNA level by real-time PCR in each experimental round. In addition, knockdown of candidate genes at the protein level were confirmed by Western Blot analysis. For the simultaneous detection of both Aβx-40 and Aβx-42 or phospho(Thr231)-Tau and total Tau, we used specific multiplex electrochemiluminescence assays for analysis of the conditioned neuronal culture medium or the recovered protein fraction of the whole cell lysate respectively. Knockdown of the positive control APP led to the expected reduction of both Aβx-40 and Aβx-42 without altering Tau levels (Fig. 1A) while transfection of MAPT siRNA significantly lowered the signal of total and phospho (Thr231)-Tau without affecting Aβ (Fig. 1B), thus proving the functionality of the RNAi approach and the validity of the assays.

    Silencing any of the tested Alzgenes did not affect secreted Aβx-40 and Aβx-42 or the Aβx-42:Aβx-40 ratio (Fig. 1A) nor did it alter total Tau and phospho(Thr231)-Tau levels (Fig.1B). Our results suggest that, in wildtype mouse primary cortical/hippocampal neurons, acute knockdown of the studied LOAD risk genes does not crucially impact on γ-secretase mediated APP processing nor on total Tau levels or Tau(Thr231)-phosphorylation. Susceptibility to AD through these genes might involve effects on APP processing or Tau that build up only over a longer time or only at a later stage, when neurons have already undergone substantial aging. Alternatively, these genes might play a role in mediating Aβ toxicity to neurons, or alter Aβ clearance pathways by non-neuronal cell types, or modulate Aβ aggregation. Indeed, experimental evidence for multiple of these possible mechanisms have been provided by previous studies for several of the herein studied susceptibility genes. For example, in addition to the aforementioned roles of APOE, CLU and PICALM in facilitating Aβ clearance, APOE lipoproteins were shown to regulate the association of oligomeric Aβ with synapses[16], CLU and CST3 were shown to inhibit Aβ aggregation[17][18][19][20] and PRNP was shown to play a role in mediating the deleterious effects of Aβ on synaptic transmission and learning and memory[21][22][23][24][25][27], though this finding was challenged by at least 3 other groups[28][29][30]. Importantly, while in our study the knockdown of the tested genes in mouse primary neurons altered neither Aβx-40 and Aβx-42 nor total Tau and phospho(Thr231)-Tau levels, a number of previous studies using different systems reported effects on Aβ or Tau pathology for some of the tested genes. APOE, for example, was shown to regulate neuronal Aβ production by modulating APP recycling[31] or APP transcription[32] when applied extracellularly. It is conceivable that the reason why we did not observe any effects of APOE knockdown on Aβx-40 and Aβx-42 is because it is expressed mainly by astrocytes and produced only at low amounts by primary neuronal cultures as used for our study. For BIN1, conflicting results have been reported on its role in Aβ regulation: while depletion of BIN1 in neurons resulted in a slight decrease in secreted Aβ40 with a concomitant increase in intracellular Aβ40 and Aβ42 in one study[33], increased levels of secreted Aβ were observed by another group[34] and no effects were detected in neuroblastoma cells in a third study[35]. Similarly, also for PICALM the observed effects on Aβ are diverging: in one study, PICALM was reported to promote Aβ generation in cells and to accelerate Aβ pathology in APP transgenic mice[36] whereas another study observed no effect on cellular Aβ production[37]. As for PRNP, a direct role was proposed in the regulation of Aβ production through inhibition of β-secretase-mediated cleavage of APP[38]. In our study, neither Aβx-40 nor Aβx-42 levels changed upon knockdown of BIN1, PICALM or PRNP in mouse primary neurons. Our results thus suggest that the overall APP processing by γ-secretase is not altered by downregulation of either of these genes in young cultured wild-type neurons. Since the assay used in our analysis was chosen so as to detect all Aβx-40 and Aβx-42 species produced by γ-secretase, comprising full-length Aβ and the shorter Aβ' and p3 peptides[39], our data do not necessarily challenge earlier findings on altered full length Aβ levels. Regarding Tau pathology, only for BIN1 a link has been reported previously: BIN1 expression was shown to correlate with the amount of neurofibrillary tangles (NFT) or total-Tau/phospho-Tau in AD patients in 2 studies[40][41] and a direct interaction between BIN1 and Tau was suggested by another[42]. However, no significant overlap between BIN1 and neurofibrillary tangles was seen in a more recent study[43]. Previously reported effects of experimentally altered BIN1 expression on Tau pathology have been controversial too. While loss of BIN1 was shown to reduce Tau mediated neurodegeneration in Drosophila[42], it reduced the propagation of Tau pathology in an in vitro system[44]. We did not observe a significant effect of BIN1 downregulation on wildtype total Tau or pTau(Thr231) levels in our study. Effects on Tau pathology progression as seen in the earlier studies might possibly require a disease context as provided by the presence of Tau mutations in these studies.

    Conclusionslink

    Our results show that acute downregulation of the studied LOAD risk genes in mouse primary neurons does not significantly alter γ-secretase mediated APP processing, Tau levels or Tau(Thr231)-phosphorylation. Susceptibility to AD through these genes might be conferred through other mechanisms, for example modulation of Aβ clearance or Aβ aggregation/toxicity as it has been proposed by some of the studies discussed above and/or Aβ and Tau-independent signaling pathways that directly affect neuronal function.

    Limitationslink

    There are 3 important limitations to our study:

    1. The in vitro character of the study: The simple intercellular connections that are formed in a primary neuronal culture do not allow to model the complex interactions that occur in an intact brain. Any effects that depend on the network activity within or between certain brain areas can therefore not be assessed by our model.

    2. The limited time frame during which we assessed the role of the studied Alzgenes: Knockdowns were performed for about 72 h. Any effects on APP processing or Tau that build up only over a longer period, as it might be the case in AD, would not be detected in our system.

    3. The age of the primary neurons: Primary neuronal cultures were prepared from embryonic neurons, thus neurons in their very early developmental stage. LOAD, however, is a disease of the aged brain. The expression profiles of the tested Alzgenes and their interaction partners might be very different in young and old neurons.

    Conjectureslink

    We are now planning to study the role of the respective risk gene variants in neurons derived from human induced pluripotent stem cells (iPSCs) which have been modified using CRISPR/Cas9 technology for targeted genome editing to introduce the respective LOAD associated genetic polymorphisms. This will not only allow us to assess long-term effects of the respective risk variants on APP processing and Tau homeostasis but also to test whether these genes would have any roles in neuronal physiology and function in an Aβ and Tau independent manner.

    Methodslink

    Mouse primary neuronal cultures

    Mixed cortical/hippocampal primary neuronal cultures were prepared from E16 ICR (CD-1®) outbred mice (Harlan Laboratories, Horst, Netherlands). Cortices with adjacent hippocampi were dissected in ice-cold HBSS, incubated in 7 ml TrypLe Express for 10 min at 37°C and triturated in Dulbecco’s modified Eagle’s medium (DMEM) (1 g/l glucose) containing 5% FCS (all from Life Technologies) through repeated pipetting with a 5 ml serological pipette and then passed through a 70 µM cell strainer. Neurons were cultured in Neurobasal medium supplemented with B27 (1:50) and 1 mM GlutaMax (all from Life Technologies, Zug, Switzerland) on 96-well plates coated with poly-D-lysine (Sigma Aldrich, St. Gallen, Switzerland) in a humidified incubator at 37°C in a 5% (vol/vol) CO2 atmosphere.

    siRNA transfection

    4DIV primary neurons were transfected with 50 nM of siRNA (stealth siRNA, Life Technologies, Zug, Switzerland) using Lipofectamine RNAiMax (Life Technologies, Zug, Switzerland) as transfection reagent. For each gene, a pool of 4 different siRNA duplexes was used. A pool of 3 different non-targeting siRNAs served as negative control. For each well of a 96-well plate 0.4 µl of RNAiMax were mixed with siRNA and Neurobasal (Life Technologies, Zug, Switzerland) in a final volume of 20 µl. The mix was incubated for 25 min at RT and then further diluted with Neurobasal medium to 100 µl. Cells were incubated with the transfection mix for 6 h, after which the medium on the cells was again replaced with Neurobasal medium supplemented with B27 (1:50) and 1 mM GlutaMax (all from Life Technologies, Zug, Switzerland).

    siRNAs

    negative controls

    medGC duplex #1 Life Technologies #12935-111

    medGC duplex #2 Life Technologies #12935-112

    medGC duplex #3 Life Technologies #12935-113

    APP

    Sense sequence 1 GCGGAUGGAUGUUUGUGAGACCCAU

    Sense sequence 2 UCAGGAUUUGAAGUCCGCCAUCAAA

    Sense sequence 3 GACCAGGUUCUGGGCUGACAAACAU

    Sense sequence 4 CACACACCCACAUCGUGAUUCCUUA

    APOE

    Sense sequence 1 GGUUCGAGCCAAUAGUGGAAGACAU

    Sense sequence 2 GCAGAGCUCCCAAGUCACACAAGAA

    Sense sequence 3 GAUGGAGGAACAGACCCAGCAAAUA

    Sense sequence 4 GAGAAUCAAUGAGUAUCCUUCUCCU

    BIN1

    Sense sequence 1 CCUGGCAGGGAUGAAGCAAACAAGA

    Sense sequence 2 UCGGACCUAUCUGGCUUCUGUUAAA

    Sense sequence 3 GAUGACGCAUUUGUCCCUGAGAUCA

    Sense sequence 4 AAGAGAUGAGUAAGCUCAAUCAGAA

    CLU

    Sense sequence 1 UCUCUGACAAUGAGCUCCAAGAACU

    Sense sequence 2 UGUACUUGAGCAGAGCGCUAUAAAU

    Sense sequence 3 ACGCCAUGAAGAUUCUCCUGCUGUG

    Sense sequence 4 CCACUCAAGGGAGUAGGUAUAUUAA

    PICALM

    Sense sequence 1 GGGAGAUCCUUUCUCUGCUACUCUA

    Sense sequence 2 GCUUGACUUGCAGCAGCCAACCUUU

    Sense sequence 3 UGGCUCCGCGGUAUCUAAGACAGUA

    Sense sequence 4 CAGCAGUCUUCUUGAUGCUUUAGAA

    PRNP

    Sense sequence 1 GGGACAACCUCAUGGUGGUAGUUGG

    Sense sequence 2 CCAGUGGAUCAGUACAGCAACCAGA

    Sense sequence 3 UGGAGCAGAUGUGCGUCACCCAGUA

    Sense sequence 4 CACGACUGCGUCAAUAUCACCAUCA

    CST3

    Sense sequence 1 CCAGACAAAUUUGACUGACUGUCCU

    Sense sequence 2 AGGCACUCUGCUCCUUCCAGAUCUA

    Sense sequence 3 GACUUCGCUGUGAGCGAGUACAACA

    Sense sequence 4 CAGCUCGUGGCUGGAGUGAACUAUU

    MAPT

    Sense sequence 1 CAGGAGGUGGCCAGGUGGAAGUAAA

    Sense sequence 2 CAGGAGGUGGCAAGGUGCAGAUAAU

    Sense sequence 3 CAGUCGAAGAUUGGCUCCUUGGAUA

    Sense sequence 4 CAAGACAGACCAUGGAGCAGAAAUU

    TARDBP

    Sense sequence 1 GCAAUCUGGUAUAUGUUGUCAACUA

    Sense sequence 2 CGAAAGGGUUUGGCUUUGUUCGAUU

    Sense sequence 3 GAAAUACCAUCAGAAGACGAUGGGA

    Sense sequence 4 CCUCCCUGUUGAGUGAGGCUAUUUA

    RELN

    Sense sequence 1 GCUCUCAAACUGGAUUUCAAGAUAA

    Sense sequence 2 CCUGGGUGAUCGACCAGAUUCUUAU

    Sense sequence 3 GAGAGCUCAUUAUACAGCCAGGAUA

    Sense sequence 4 CAGUUCCAUGAAGCCACCAUUUAUA

    KAT5

    Sense sequence 1 AGCCUGGACGGAAGCGGAAAUCUAA

    Sense sequence 2 CGGCACCCUCCAGGCAAUGAAAUUU

    Sense sequence 3 CGUAAUGACGGAGUAUGACUGCAAA

    Sense sequence 4 CACACUGCAGUAUCUCAACCUCAU

    SNCA

    Sense sequence 1 GCAAGUGACAAAUGUUGGAGGAGCA

    Sense sequence 2 GGGAGUCCUCUAUGUAGGUUCCAAA

    Sense sequence 3 CCAAGACUAUGAGCCUGAAGCCUAA

    Sense sequence 4 CACAGGAAGGAAUCCUGGAAGACAU

    Alamar Blue assay

    Alamar Blue metabolisation was used as an indirect measure of cell number and viability of primary neurons. Alamar BlueTM assay reagent (AbD Serotec Ltd, Bio-Rad, Cressier, Switzerland) was added to the cells at a final concentration of 10% for the final 3 h before termination of the medium collection period. Levels of the metabolite resofurin were assessed by 544EX nm/590EM nm fluorescence measurements with the Spectra MAX-GEMINI-XS spectrofluorometer (Molecular-Devices, Sunnyvale, CA, USA).

    RNA isolation

    For RNA extraction, adherent neurons were briefly washed with PBS (containing CaCl2 and MgCl2) and lysed in 100 µl TRI-Reagent (Sigma-Aldrich, Buchs, Switzerland) per well. Lysates of technical replicates of each experimental condition were pooled and isolation of RNA was performed according to manufacturer's instructions. All RNA samples were subjected to DNase treatment using 0.5 units of DNaseI (Fermentas; Life Technologies, Zug, Switzerland) for 30 min at 37°C. DNase was heat inactivated by a 10 min incubation at 65°C in the presence of 5 mM EDTA. RNA concentrations were measured with a Nanodrop 2000 UV-Vis spectrophotometer (Thermo Scientific, Waltham, MA, USA).

    Protein isolation

    Protein was recovered from the organic/phenol phase that was obtained during RNA isolation with TRI-Reagent (Sigma-Aldrich, Buchs, Switzerland) following the manufacturer’s protocol for protein precipitation with acetone. The obtained protein pellet was resuspended in 9.5 M Urea (pH 9.0), 2% CHAPS. For analysis by electrochemiluminescence multiplex assay, samples were diluted 1:100 with TBS (pH 7.5) containing 0.05% Tween and 1% BlockerA (Meso Scale Discovery).

    cDNA synthesis

    For each sample 500 ng of total RNA was reverse-transcribed using the iScript cDNA-Synthesis-kit (Bio-Rad, Cressier, Switzerland) according to manufacturer’s instructions.

    Real-time PCR

    Real-time PCR for relative quantification of cDNA levels was performed with the 7900HT Real-Time PCR System (Life-Technologies, Zug, Switzerland), using the iTaq-SybrGreen Supermix with ROX (Bio-Rad, Cressier, Switzerland). Relative gene expression levels were calculated with the ΔΔCt-method using GAPDH for normalization.

    Real-time PCR primer

    GAPDH

    Forward primer ATCACTGCCACCCAGAAGAC

    Reverse primer GGATGCAGGGATGATGTTCT

    APP

    Forward primer ACCGTTGCCTAGTTGGTGAGT

    Reverse primer CGGTGTGCCAGTGAAGATG

    APOE

    Forward primer CTGAACCGCTTCTGGGATTAC

    Reverse primer CCATCAGTGCCGTCAGTTCT

    BIN1

    Forward primer GAAGATCGCCAGCAACGTAC

    Reverse primer TGCTCAAACTGCTCGTCCTT

    CLU

    Forward primer CGTCCAGGGAGTGAAGCA

    Reverse primer AATCCCTAGTGTCCTCCAGAGC

    PICALM

    Forward primer AAGGTTGCACCAACAACTGC

    Reverse primer CTATCATGCCCGTTGGTGTAGT

    PRNP

    Forward primer TCCATTTTGGCAACGACTG

    Reverse primer TCGTGCACGAAGTTGTTCTG

    CST3

    Forward primer TACAACAAGGGCAGCAACG

    Reverse primer TAGTTCGGCCCATCTCCAC

    MAPT

    Forward primer TCGCCAGGAGTTTGACACA

    Reverse primer GTCTCCGATGCCTGCTTCT

    TARDBP

    Forward primer GAAGACGATGGGACGGTGT

    Reverse primer TCCACCAGTCGGACTCCTC

    RELN

    Forward primer CAAGGTGACGACTGCTCTGTC

    Reverse primer ACTCCACCCTGGATGGTTTC

    KAT5

    Forward primer CCTGTGTCTTCTGGCCAAGT

    Reverse primer CCCACGATGTGGAAACCTT

    SNCA

    Forward primer ATGTTGGAGGAGCAGTGGTG

    Reverse primer GCCCATCTGGTCCTTCT

    Electrochemiluminescence assay

    x-40 and Aβx-42 levels in 24 h conditioned medium of 8DIV mouse primary neurons were analyzed with the Aβ-Panel1 (4G8) Kit (Meso Scale Discovery, Maryland, USA) following the manufacturer’s instructions. To each well of a 96-well assay plate 25 µl of 1:50 diluted Sulfo-Tag 4G8 mAb detection antibody and 25 µl of conditioned medium were added and incubated overnight at 4°C. Total Tau and phosphoThr231-Tau from 8DIV mouse primary neuronal cultures were assayed in the recovered protein fraction with the Phospho(Thr231)/Total Tau Kit (Meso Scale Discovery, Maryland, USA) following the manufacturer’s instructions. To each well of a 96-well assay plate 25 µl of sample were added and incubated for 2 h at RT on a shaker at 750 rpm. Incubation with the detection antibody was for 1 h at RT on a shaker at 750 rpm using 25 µl of Sulfo-Tag anti-Tau antibody per well at a concentration of 1 µg/ml. Measurements were taken on a Sector-Imager-6000 (Meso-Scale-Discovery, Maryland, USA). Electrochemiluminescence values were normalized to the corresponding Alamar-Blue assay values.

    SDS-PAGE and Western blot

    Proteins were separated on 4–12% Bis-Tris gels (Life Technologies, Zug, Switzerland) and blotted on 0.2µm Nitrocellulose membranes (Life Technologies, Zug, Switzerland). Unspecific binding was blocked by preincubation of membranes with TBS-Tween(0.05%) containing 5% w/v nonfat milk powder. Incubation with primary antibodies was performed overnight at 4°C, incubation with secondary antibodies for 1 h at room temperature. Infrared signal at 700 nm and 800 nm were acquired with an Odyssey CLx Imaging System (Li-COR Biosciences, Bad Homburg, Germany).

    Primary antibodies

    goat anti-ApoE (Santa Cruz # sc-6384) 1:100

    rabbit anti-Bin1 (Proteintech # 14647-1-AP) 1:1000

    goat anti-ApoJ/Clu (Abcam # ab79280) 1:500

    rabbit anti-Picalm (Abcam # ab106409) 1:500

    mouse anti-PrnP (Abcam # ab61409) 1:500

    rabbit anti-Cst3 (Proteintech # 12245-1-AP) 1:1000

    mouse anti-β-Actin (Abcam # ab6276) 1:10000

    mouse anti-Gapdh (Life Technologies # AM4300) 1:5000

    Secondary antibodies

    donkey anti-mouse IRDye 800CW (Li-COR Biosciences # 926-32212) 1:5000

    donkey anti-rabbit IRDye 800CW (Li-COR Biosciences # 926-32213) 1:5000

    donkey anti-goat IRDye 800CW (Li-COR Biosciences # 926-32214) 1:5000

    donkey anti-mouse IRDye 680RD (Li-COR Biosciences # 926-68072) 1:5000

    Funding Statementlink

    L. R. was supported by the Swiss National Science Foundation grants (Sinergia and Core Interdisciplinary grants), by the Velux Foundation, the Novartis Foundation grant, the Cure Alzheimer Foundation, the Hurka Stiftung, the Bangerter Stiftung, the Baugarten Stiftung and the Synapsis Foundation. G. S. was supported by an EMBO long-term fellowship (ALTF 668-2011) and the University of Zurich’s Forschungskredit (K-82033-02-01).

    Acknowledgementslink

    We thank the lab members for their stimulating discussions.

    Conflict of interestlink

    The authors declare no conflicts of interest.

    Ethics Statementlink

    All animal experiments were done according to the guidelines of and approved by the veterinary office of the Canton of Zürich, Switzerland.

    No fraudulence is committed in performing these experiments or during processing of the data. We understand that in the case of fraudulence, the study can be retracted by ScienceMatters.

    Referenceslink
    1. Jitin Bali, Ali Hashemi Gheinani, Sebastian Zurbriggen, Lawrence Rajendran
      Role of genes linked to sporadic Alzheimer's disease risk in the production of beta-amyloid peptides
      Proceedings of the National Academy of Sciences, 109/2012, pages 15307-15311 chrome_reader_mode
    2. Lars Bertram, Matthew B McQueen, Kristina Mullin, Deborah Blacker, Rudolph E Tanzi
      Systematic meta-analyses of Alzheimer disease genetic association studies: the AlzGene database
      Nature Genetics, 39/2007, pages 17-23 chrome_reader_mode
    3. Ashford, J. Wessona, Mortimer, James A.
      Non-familial Alzheimer's disease is mainly due to genetic factors
      Journal of Alzheimer's Disease, 4/2002, pages 169-177 chrome_reader_mode
    4. Nilüfer Ertekin-Taner
      Genetics of Alzheimer's Disease: A Centennial Review
      Neurologic Clinics, 25/2007, pages 611-667 chrome_reader_mode
    5. Nilüfer Ertekin-Taner
      Genetics of Alzheimer disease in the pre- and post-GWAS era
      Alzheimer's Research & Therapy, 2/2010, page 3 chrome_reader_mode
    6. Margaret Gatz, Chandra A. Reynolds, Laura Fratiglioni, Boo Johansson, James A. Mortimer, Stig Berg, Amy Fiske, Nancy L. Pedersen
      Role of Genes and Environments for Explaining Alzheimer Disease
      Archives of General Psychiatry, 63/2006, pages 168-174 chrome_reader_mode
    7. Livingston Gill, Sommerlad Andrew, Orgeta Vasiliki,more_horiz, Mukadam Naaheed
      Dementia prevention, intervention, and care
      The Lancet, 390/2017, pages 2673-2734 DOI: 10.1016/s0140-6736(17)31363-6chrome_reader_mode
    8. Kwasi G. Mawuenyega, Wendy Sigurdson, Vitaliy Ovod, Ling Munsell, Tom Kasten, John C. Morris, Kevin E. Yarasheski, Randall J. Bateman
      Decreased Clearance of CNS β-Amyloid in Alzheimer’s Disease
      Science, 330/2010, page 1774 chrome_reader_mode
    9. Weller Roy O., Subash Malavika, Preston Stephen D.,more_horiz, Carare Roxana O.
      SYMPOSIUM: Clearance of Aβ from the Brain in Alzheimer's Disease: Perivascular Drainage of Amyloid‐β Peptides from the Brain and Its Failure in Cerebral Amyloid Angiopathy and Alzheimer's Disease
      Brain Pathology, 18/2008, pages 253-266 chrome_reader_mode
    10. Jian-Sheng Gong, Mariko Kobayashi, Hideki Hayashi, Kun Zou, Naoya Sawamura, Shinobu C. Fujita, Katsuhiko Yanagisawa, Makoto Michikawa
      Apolipoprotein E (ApoE) Isoform-dependent Lipid Release from Astrocytes Prepared from Human ApoE3 and ApoE4 Knock-in Mice
      The Journal of Biological Chemistry, 277/2002, pages 29919-29926 chrome_reader_mode
    11. Rashid Deane, Abhay Sagare, Katie Hamm, Margaret Parisi, Steven Lane, Mary Beth Finn, David M. Holtzman, Berislav V. Zlokovic
      apoE isoform-specific disruption of amyloid beta peptide clearance from mouse brain
      The Journal of Clinical Investigation, 118/2008, pages 4002-4013 chrome_reader_mode
    12. Robert D Bell, Abhay P Sagare, Alan E Friedman, Gurrinder S Bedi, David M Holtzman, Rashid Deane, Berislav V Zlokovic
      Transport Pathways for Clearance of Human Alzheimer's Amyloid β-Peptide and Apolipoproteins E and J in the Mouse Central Nervous System
      Journal of Cerebral Blood Flow & Metabolism, 27/2007, pages 909-918 chrome_reader_mode
    13. Merino-Zamorano Cristina, Fernández-de Retana Sofía, Montañola Alex,more_horiz, Hernández-Guillamon Mar
      Modulation of Amyloid-β1–40 Transport by ApoA1 and ApoJ Across an in vitro Model of the Blood-Brain Barrier
      Journal of Alzheimer's Disease, 53/2016, pages 677-691 DOI: 10.3233/jad-150976chrome_reader_mode
    14. B V Zlokovic, C L Martel, E Matsubara, J G McComb, G Zheng, R T McCluskey, B Frangione, J Ghiso
      Glycoprotein 330/megalin: probable role in receptor-mediated transport of apolipoprotein J alone and in a complex with Alzheimer disease amyloid beta at the blood-brain and blood-cerebrospinal fluid barriers
      Proceedings of the National Academy of Sciences, 93/1996, pages 4229-4234 chrome_reader_mode
    15. Zhen Zhao, Abhay P Sagare, Qingyi Ma, Matthew R Halliday, Pan Kong, Kassandra Kisler, Ethan A Winkler, Anita Ramanathan, Takahisa Kanekiyo, Guojun Bu, Nelly Chuqui Owens, Sanket V Rege, Gabriel Si, Ashim Ahuja, Donghui Zhu, Carol A Miller, Julie A Schneider, Manami Maeda, Takahiro Maeda, Tohru Sugawara, Justin K Ichida, Berislav V Zlokovic
      Central role for PICALM in amyloid-β blood-brain barrier transcytosis and clearance
      Nature Neuroscience, 18/2015, pages 978-987 chrome_reader_mode
    16. Robert M. Koffie, Tadafumi Hashimoto, Hwan-Ching Tai, Kevin R. Kay, Alberto Serrano-Pozo, Daniel Joyner, Steven Hou, Katherine J. Kopeikina, Matthew P. Frosch, Virginia M. Lee, David M. Holtzman, Bradley T. Hyman, Tara L. Spires-Jones
      Apolipoprotein E4 effects in Alzheimer’s disease are mediated by synaptotoxic oligomeric amyloid-β
      Brain, 135/2012, pages 2155-2168 chrome_reader_mode
    17. Marten Beeg, Matteo Stravalaci, Margherita Romeo, Arianna Dorotea Carrá, Alfredo Cagnotto, Alessandro Rossi, Luisa Diomede, Mario Salmona, Marco Gobbi
      Clusterin Binds to Aβ1–42 Oligomers with High Affinity and Interferes with Peptide Aggregation by Inhibiting Primary and Secondary Nucleation
      The Journal of Biological Chemistry, 291/2016, pages 6958-6966 chrome_reader_mode
    18. Magdalena Sastre, Miguel Calero, Monika Pawlik, Paul M Mathews, Asok Kumar, Vlatko Danilov, Stephen D Schmidt, Ralph A Nixon, Blas Frangione, Efrat Levy
      Binding of cystatin C to Alzheimer’s amyloid β inhibits in vitro amyloid fibril formation
      Neurobiology of Aging, 25/2004, pages 1033-1043 chrome_reader_mode
    19. M. L. Selenica, X. Wang, L. Ostergaard‐pedersen, A. Westlind‐danielsson, A. Grubb
      Cystatin C reduces the in vitro formation of soluble Aβ1‐42 oligomers and protofibrils
      Scandinavian Journal of Clinical and Laboratory Investigation , 67/2007, pages 179-190 chrome_reader_mode
    20. Tizon, Belena, Ribe, Elena M., Mi, Weiqiana,more_horiz, Levy, Efrata
      Cystatin C Protects Neuronal Cells from Amyloid-β-induced Toxicity
      Journal of Alzheimer's Disease, 19/2010, pages 885-894 chrome_reader_mode
    21. Andrew E. Barry, Igor Klyubin, Jessica M. Mc Donald, Alexandra J. Mably, Michael A. Farrell, Michael Scott, Dominic M. Walsh, Michael J. Rowan
      Alzheimer's Disease Brain-Derived Amyloid-β-Mediated Inhibition of LTP In Vivo Is Prevented by Immunotargeting Cellular Prion Protein
      Journal of Neuroscience, 31/2011, pages 7259-7263 chrome_reader_mode
    22. Darragh B. Freir, Andrew J. Nicoll, Igor Klyubin, Silvia Panico, Jessica M. Mc Donald, Emmanuel Risse, Emmanuel A. Asante, Mark A. Farrow, Richard B. Sessions, Helen R. Saibil, Anthony R. Clarke, Michael J. Rowan, Dominic M. Walsh, John Collinge
      Interaction between prion protein and toxic amyloid β assemblies can be therapeutically targeted at multiple sites
      Nature Communications, 2/2011, page 336 chrome_reader_mode
    23. David A. Gimbel, Haakon B. Nygaard, Erin E. Coffey, Erik C. Gunther, Juha Laurén, Zachary A. Gimbel, Stephen M. Strittmatter
      Memory Impairment in Transgenic Alzheimer Mice Requires Cellular Prion Protein
      Journal of Neuroscience, 30/2010, pages 6367-6374 chrome_reader_mode
    24. Neng-Wei Hu, Andrew J. Nicoll, Dainan Zhang, Alexandra J. Mably, Tiernan O’malley, Silvia A. Purro, Cassandra Terry, John Collinge, Dominic M. Walsh, Michael J. Rowan
      mGlu5 receptors and cellular prion protein mediate amyloid-β-facilitated synaptic long-term depression in vivo
      Nature Communications, 5/2014, page 3374 chrome_reader_mode
    25. Igor Klyubin, Andrew J. Nicoll, Azadeh Khalili-Shirazi, Michael Farmer, Stephanie Canning, Alexandra Mably, Jacqueline Linehan, Alexander Brown, Madeleine Wakeling, Sebastian Brandner, Dominic M. Walsh, Michael J. Rowan, John Collinge
      Peripheral Administration of a Humanized Anti-PrP Antibody Blocks Alzheimer's Disease Aβ Synaptotoxicity
      Journal of Neuroscience, 34/2014, pages 6140-6145 chrome_reader_mode
    26. Juha Laurén, David A. Gimbel, Haakon B. Nygaard, John W. Gilbert, Stephen M. Strittmatter
      Cellular prion protein mediates impairment of synaptic plasticity by amyloid-β oligomers
      Nature, 457/2009, pages 1128-1132 chrome_reader_mode
    27. Ji Won Um, Haakon B Nygaard, Jacqueline K Heiss, Mikhail A Kostylev, Massimiliano Stagi, Alexander Vortmeyer, Thomas Wisniewski, Erik C Gunther, Stephen M Strittmatter
      Alzheimer amyloid-β oligomer bound to postsynaptic prion protein activates Fyn to impair neurons
      Nature Neuroscience, 15/2012, pages 1227-1235 chrome_reader_mode
    28. Claudia Balducci, Marten Beeg, Matteo Stravalaci, Antonio Bastone, Alessandra Sclip, Emiliano Biasini, Laura Tapella, Laura Colombo, Claudia Manzoni, Tiziana Borsello, Roberto Chiesa, Marco Gobbi, Mario Salmona, Gianluigi Forloni
      Synthetic amyloid-β oligomers impair long-term memory independently of cellular prion protein
      Proceedings of the National Academy of Sciences, 107/2010, pages 2295-2300 chrome_reader_mode
    29. Anna Maria Calella, Mélissa Farinelli, Mario Nuvolone, Osvaldo Mirante, Rita Moos, Jeppe Falsig, Isabelle M. Mansuy, Adriano Aguzzi
      Prion protein and Aβ‐related synaptic toxicity impairment
      EMBO Molecular Medicine, 2/2010, pages 306-314 chrome_reader_mode
    30. Helmut W. Kessels, Louis N. Nguyen, Sadegh Nabavi, Roberto Malinow
      The prion protein as a receptor for amyloid-β
      Nature, 466/2010, pages E3-E4 chrome_reader_mode
    31. Shiming Ye, Yadong Huang, Karin Müllendorff, Liming Dong, Gretchen Giedt, Elaine C. Meng, Fred E. Cohen, Irwin D. Kuntz, Karl H. Weisgraber, Robert W. Mahley
      Apolipoprotein (apo) E4 enhances amyloid β peptide production in cultured neuronal cells: ApoE structure as a potential therapeutic target
      Proceedings of the National Academy of Sciences, 102/2005, pages 18700-18705 chrome_reader_mode
    32. Yu-Wen Alvin Huang, Bo Zhou, Marius Wernig, Thomas C. Südhof
      ApoE2, ApoE3, and ApoE4 Differentially Stimulate APP Transcription and Aβ Secretion
      Cell, 168/2017, pages 427-441.e21 chrome_reader_mode
    33. Florent Ubelmann, Tatiana Burrinha, Laura Salavessa, Ricardo Gomes, Cláudio Ferreira, Nuno Moreno, Cláudia Guimas Almeida
      Bin1 and CD2AP polarise the endocytic generation of beta‐amyloid
      EMBO reports, 18/2016, page e201642738 chrome_reader_mode
    34. Toji Miyagawa, Ihori Ebinuma, Yuichi Morohashi, Yukiko Hori, Mee Young Chang, Haruhiko Hattori, Tomoaki Maehara, Satoshi Yokoshima, Tohru Fukuyama, Shoji Tsuji, Takeshi Iwatsubo, George C. Prendergast, Taisuke Tomita
      BIN1 regulates BACE1 intracellular trafficking and amyloid-β production
      Human Molecular Genetics, 25/2016, pages 2948-2958 chrome_reader_mode
    35. Elizabeth B. C. Glennon, Isobel J. Whitehouse, J. Scott Miners, Patrick G. Kehoe, Seth Love, Katherine A. B. Kellett, Nigel M. Hooper
      BIN1 Is Decreased in Sporadic but Not Familial Alzheimer’s Disease or in Aging
      PLoS ONE, 8/2013, page e78806 chrome_reader_mode
    36. Qingli Xiao, So-Chon Gil, Ping Yan, Yan Wang, Sharon Han, Ernie Gonzales, Ronaldo Perez, John R. Cirrito, Jin-Moo Lee
      Role of Phosphatidylinositol Clathrin Assembly Lymphoid-Myeloid Leukemia (PICALM) in Intracellular Amyloid Precursor Protein (APP) Processing and Amyloid Plaque Pathogenesis
      The Journal of Biological Chemistry, 287/2012, pages 21279-21289 chrome_reader_mode
    37. Fangbai Wu, Yasuji Matsuoka, Mark P. Mattson, Pamela J. Yao
      The clathrin assembly protein AP180 regulates the generation of amyloid-β peptide
      Biochemical and Biophysical Research Communications, 385/2009, pages 247-250 chrome_reader_mode
    38. Edward T. Parkin, Nicole T. Watt, Ishrut Hussain, Elizabeth A. Eckman, Christopher B. Eckman, Jean C. Manson, Herbert N. Baybutt, Anthony J. Turner, Nigel M. Hooper
      Cellular prion protein regulates β-secretase cleavage of the Alzheimer's amyloid precursor protein
      Proceedings of the National Academy of Sciences, 104/2007, pages 11062-11067 chrome_reader_mode
    39. Gabriele Siegel, Hermeto Gerber, Philipp Koch,more_horiz, Lawrence Rajendran
      The Alzheimer’s Disease γ-Secretase Generates Higher 42:40 Ratios for β-Amyloid Than for p3 Peptides
      Cell Reports, 19/2017, pages 1967-1976 DOI: 10.1016/j.celrep.2017.05.034chrome_reader_mode
    40. Holler, C. J., Davis, P. R., Beckett, T. L.,more_horiz, Murphy, M. Paul
      Bridging Integrator 1 (BIN1) Protein Expression Increases in the Alzheimer's Disease Brain and Correlates with Neurofibrillary Tangle Pathology
      Journal of Alzheimer's Disease, 42/2014, pages 1221-1227 chrome_reader_mode
    41. Wang, Hui-Fu, Wan, Yu, Hao, Xiao-Ke,more_horiz, Disease Neuroimaging Initiative Alzheimer’s
      Bridging Integrator 1 (BIN1) Genotypes Mediate Alzheimer’s Disease Risk by Altering Neuronal Degeneration
      Journal of Alzheimer's Disease, 52/2016, pages 179-190 chrome_reader_mode
    42. J Chapuis, F Hansmannel, M Gistelinck, A Mounier, C van Cauwenberghe, K V Kolen, F Geller, Y Sottejeau, D Harold, P Dourlen, B Grenier-Boley, Y Kamatani, B Delepine, F Demiautte, D Zelenika, N Zommer, M Hamdane, C Bellenguez, J-F Dartigues, J-J Hauw, F Letronne, A-M Ayral, K Sleegers, A Schellens, L V Broeck, S Engelborghs, P P de Deyn, R Vandenberghe, M O'Donovan, M Owen, J Epelbaum, M Mercken, E Karran, M Bantscheff, G Drewes, G Joberty, D Campion, J-N Octave, C Berr, M Lathrop, P Callaerts, D Mann, J Williams, L Buée, I Dewachter, C van Broeckhoven, P Amouyel, D Moechars, B Dermaut, J-C Lambert, Gerad Consortium
      Increased expression of BIN1 mediates Alzheimer genetic risk by modulating tau pathology
      Molecular Psychiatry, 18/2013, pages 1225-1234 chrome_reader_mode
    43. Pierre de Rossi, Virginie Buggia-Prevot, Robert J Andrew, Sofia V Krause, Elizabeth Woo, Peter T Nelson, Peter Pytel, Gopal Thinakaran
      BIN1 localization is distinct from Tau tangles in Alzheimer’s disease
    44. Sara Calafate, William Flavin, Patrik Verstreken, Diederik Moechars
      Loss of Bin1 Promotes the Propagation of Tau Pathology
      Cell Reports, 17/2016, pages 931-940 chrome_reader_mode
    Commentslink

    Create a Matters account to leave a comment.