What Matters
Why Matters
Who Matters
Articles
Your browser is out-of-date!

Update your browser to view this website correctly. Update my browser now

×

Discipline
Biological
Keywords
Neospora Caninum
Pgem-Pet28
E. Coli
Actin
Heterologous Expression
Observation Type
Standalone
Nature
Standard Data
Submitted
Jan 16th, 2017
Published
Feb 23rd, 2017
  • Abstract

    The expression of recombinant proteins in E. coli, a valuable field of biotechnology, is the basic method for protein source in several research models. The Neospora caninum actin fragment had been unsuccessfully expressed in pET28 in E. coli. To overcome this problem, we ligated the expression region of pET28 to pGEM-T Easy Vector. The new hybrid plasmid, named pGEM-pET28, was able to express for the first time an actin fragment from N. caninum that was subsequently purified in a nickel sepharose column. The pGEM-pET28 plasmid kept the N-terminal His-Tag/thrombin/T7/Tag configuration, but it is 1.577 bp smaller than the original pET28 vector and the drug selection is made with ampicillin. The plasmid pGEM-pET28 offers a new option for gene cloning directly in the plasmid for protein expression, demonstrating that the ligation of components from distinct vectors is feasible and advantageous.

  • Figure
  • Introduction

    Neospora caninum is an obligate intracellular protozoan, strongly correlated to abortion and decrease of fertility in cows, the major intermediate host. The fertility losses caused by the parasite are estimated in more than a billion dollars, disturbing several economies. The members of this phylum are characterized by an active system of invasion. The system is composed of surface and secreted adhesive proteins, which interacts with ligands from host cells and an actin-motor of the parasite. Among the methods applied for studies involving the blockage of the apicomplexan invasion system, heterologous expression in E. coli provides the primary source of potential vaccine antigens, such as AMA-1 (apical membrane antigen) and MSP2 (merozoite superficial protein) from Plasmodium falciparum. This expression system is extensively applied as a source of proteins on laboratory or industrial scale. The most evident features of expression in E. coli are the low cost and high yield of purified proteins, sometimes up to 50% of the cellular protein mass. The induction with IPTG ( isopropyl  β-D-1-thiogalactopyranoside), based on the lactose operon, allows the expression of proteins after an adequate bacterial growth. Among the several options of expression, the pET plasmids (Novagen), based on pBR322, are one of the most popular in the research and industrial fields. Several approaches based on the pET family (pET 28 and 32) and E. coli (BL21, Rosetta, Rosetta Gami) failed to express fragments of actin from N. caninum by our group. In this work, we ligated the pET28 expression region in the pGEM-T Easy Vector (Promega), generating a hybrid plasmid, named pGEM-pET28. This plasmid succeeded in expressing the actin fragment of N. caninum, representing the first description of actin from N. caninum in its recombinant form. The adaptation of plasmids for expression in E. coli is a valuable tool, which is independent of a commercial  organization, offering more options for recombinant expression.

  • Objective

    Use of a hybrid plasmid composed of pET28 and pGEM-T Easy for heterologous expression in E. coli.

  • Results & Discussion

    The expression of recombinant proteins through the application of the pET28 system has been extensively employed. This method is one of the most simple and low-cost procedures for obtaining proteins for diverse applications and is usually the first choice among biotechnologists. This work describes a new plasmid for recombinant expression based on pET28 and IPTG induction, formed by the fusion of the pET28 expression region and the pGEM-T Easy Vector. The hybrid plasmid expressed an actin fragment of N. caninum, an apicomplexan parasite related to abortion in cattle and responsible for significant losses in the cattle industry. The actin has an important role in the gliding and invasion process of apicomplexans in general, and this is the first description from N. caninum, a Toxoplasma gondii-related parasite. Several unsuccessful attempts were previously made by our group to get the recombinant N. caninum actin in expression p lasmids. This problem was solved with the pGEM-pET28 plasmid: the recombinant actin fragment of 22 kDa was promptly expressed in BL21 (Figure C, lane 2), compared to the non-induced control (Figure C, lane 3). The actin fragment was purified (Figure C, lane 4) and the identity was confirmed by mass spectrometry. A fragment (SYELPDGNIITVGNER) covering 16.7% of the expressed protein was identified with a significant score of 92. Rare codons compose approximately 10% of the N. caninum actin (38 rare codons of 375 total codons, according to ATGme software), an important factor for inhibition of protein expression in E. coli. On the other hand, the origin of replication of pGEM (pUC) present in pGEM-pET28 generates higher plasmid copies as compared to pET28, probably compensating the low expression caused by rare codons. Moreover, the reduction of the plasmid size improves transformation efficiency and stability in E. coli, a clear advantage of the pGEM-pET28 compared to pET28. The importance of actin in Apicomplexa has been extensively demonstrated using T. gondii and Plasmodium models. The use of pGEM-pET28 allows future research involving actin of N. caninum, bringing further knowledge of this protein within the phylum and its role in the invasion process. Our work demonstrates that vectors for maintenance of genes such as pGEM are also able to perform the function of expression as pET28, and pGEM-pET28 represents an option for the expression of proteins from deleterious protozoans.

  • Conclusions

    The actin fragment from N. caninum was expressed in E. coli using pGEM-pET28.

  • Limitations

    Conventional plasmids such as pET28 and pET32 failed to express N. caninum actin. This difficulty was solved with the use of pGEM-pET28. However, the recombinant actin protein was insoluble. Therefore, the next steps should be based on the solubilization of the protein. The addition of solubility-enhancement tags (such as thioredoxin or SUMO proteins) might be considered to achieve soluble and active N. caninum actin.

  • Conjectures

    High copies of pGEM-pET28 in bacteria probably compensate the low expression caused by rare codons present in actin. Thus, pGEM-pET28 is an interesting alternative to express proteins with considerable proportion of rare codons in E. coli.

  • Methods

    1. Ligation of pET28 region in pGEM plasmid

    The recombinant expression region of pET28 was amplified by PCR with the primers pET28 forward (TTTCTGCAGCACCACCCTGAATTGACTCTCT) and pET28 reverse (TTTCTGCAGGGATATAGTTCCTCCTTTCAGCA) flanked by PstI restriction sites (in italic). The forward and reverse primers were localized, respectively, at 383 bases upstream of the T7 promoter and 21 bases downstream of the T7 terminator (Figure A). The pET28 fragment was ligated in the pGEM-T Easy Vector (Promega) following the manufacturer’s instructions. The pGEM-pET28 (Figure B) plasmid was cloned in E. coli Top10, extracted with mini-prep (Wizard® Plus SV Minipreps; Promega), and confirmed by sequencing.

    2. N. caninum culture

    The tachyzoite forms of N. caninum Nc-1 isolate were cultured in Vero cell cultures as previously described. The purification of tachyzoites was performed by exclusion chromatography in Sephadex G-25 (PD-10 columns; GE). The recovered parasites were counted in a Neubauer chamber after adequate dilution and applied as the source for RNA extraction.

    3. RNA extraction and cDNA synthesis

    RNA from N. caninum was extracted following the Trizol protocol (Invitrogen). Freshly purified tachyzoites (1×107) were solubilized in 1 mL Trizol solution and extracted in 1 mL chloroform, followed by centrifugation at 10,000 g for 15 min. The resulting aqueous phase (200 mL) was replaced into a new tube and the RNA was precipitated with 200 mL absolute isopropanol. RNA was pelleted by centrifugation at 10,000 g for 15 min and washed with 500 mL 75% ethanol. The pellet was air-dried, diluted in 50 mL water and quantified in a 260/280 nm spectrophotometer (GeneQuant Pro; Amersham/GE). cDNA was obtained by reverse transcription following the manufacturer’s instructions (GoScript™ Reverse Transcription System kit). Briefly, 500 ng of RNA was incubated with 5 nM of poli-T primer for 1 h at 37°C. The actin fragment of N. caninum (ToxoDB data bank: NcLIV_003440) was amplified from the 604 to 932 bases with the primers forward NcActBamHI (TTTGGATCCACCACCTCCGCC) and reverse NcActHindIII (TTTAAGCTTCCAATACCCTCGT). The restriction sites BamHI and HindIII are shown in italic. The N. caninum actin fragment was cloned in pGEM-T Easy Vector and sequenced.

    4. Expression of actin fragment in pGEM-pET28 plasmid

    Both pGEM (with N. caninum actin fragment) and pGEM-pET28 plasmid were treated with BamHI and HindIII. The NcActin fragment, extracted from pGEM, was ligated in the hybrid plasmid. The ligation was electroporated in E. coli Top10, verified with EcoRI treatment, and sequenced. The pGEM-pET28/Actin was electroporated in E. coli BL21 and submitted to expression inducted by 1 mM IPTG. The bacterial pellets were sonicated with 8 M urea and the recombinant actin fragment was purified in an affinity nickel sepharose column (Ni Sepharose 6 Fast Flow; GE). The extracts and aliquots with the recombinant protein were analyzed by SDS-PAGE and stained with coomassie blue G.

    5. Mass spectrometry

    The band corresponding to the recombinant actin was excised and subjected to trypsin digestion. Briefly, the sample was washed three times in 25 mM NH4HCO3 pH 8.0 in 50% acetonitrile (ACN) for 15 min each wash, dehydrated in 100% ACN, and dried in a vacuum concentrator (Labconco). The gel was resuspended in 25 ng/µL trypsin solution (Trypsin Gold; Promega), incubated for 16-24 h at 37°C, and peptides extracted with 50% ACN and 5% trifluoroacetic acid (TFA). For MS/MS, the peptide solution was diluted 1:1 in α-cyano-4-hydroxycinnamic acid (10 mg/mL in 50% ACN and 0.1% TFA) and applied in a MALDI plate. The calibrant was a polyethylene glycol (PEG) solution diluted in a matrix (1:1). The identification was performed in a matrix-assisted Laser Desorption/Ionization (MALDI TOF/TOF-Bruker). The data were searched against the N. caninum predicted protein database (www.matrixscience.com), using Mascot software version 2.3.02 (Matrix Science). The carbamidomethylation of cysteine and the oxidation of methionine were set as fixed and variable modifications, respectively.

  • Funding statement

    The authors would like to thank CAPES and FAPESP for the PhD fellowship to L.M.P. (2009/07713-7).

  • Acknowledgements

    The authors would like to thank the Prof. Noberto Peporine Lopes group (Chromatography and Mass Spectrometry Facility from NPPNS-FCFRP/USP) for the technical assistance with the mass spectrometry.

  • Ethics statement

    Not applicable.

  • References
  • 1
    Lorem ipsum Lorem ipsum Lorem ipsum Lorem ipsum Lorem ipsum Lorem ipsum Lorem ipsum Lorem ipsum

    Lorem ipsum Lorem ipsum Lorem ipsum Lorem ipsum ipsum Lorem ipsum Lorem ipsum Lorem ipsum Lorem ipsum ipsum

    Lorem ipsum Lorem ipsum Lorem ipsum
    2
    Lorem ipsum Lorem ipsum Lorem ipsum Lorem ipsum Lorem ipsum Lorem ipsum Lorem ipsum Lorem ipsum

    Lorem ipsum Lorem ipsum Lorem ipsum Lorem ipsum ipsum Lorem ipsum Lorem ipsum Lorem ipsum Lorem ipsum ipsum

    Lorem ipsum Lorem ipsum Lorem ipsum
    3
    Lorem ipsum Lorem ipsum Lorem ipsum Lorem ipsum Lorem ipsum Lorem ipsum Lorem ipsum Lorem ipsum

    Lorem ipsum Lorem ipsum Lorem ipsum Lorem ipsum ipsum Lorem ipsum Lorem ipsum Lorem ipsum Lorem ipsum ipsum

    Lorem ipsum Lorem ipsum Lorem ipsum
    4
    Lorem ipsum Lorem ipsum Lorem ipsum Lorem ipsum Lorem ipsum Lorem ipsum Lorem ipsum Lorem ipsum

    Lorem ipsum Lorem ipsum Lorem ipsum Lorem ipsum ipsum Lorem ipsum Lorem ipsum Lorem ipsum Lorem ipsum ipsum

    Lorem ipsum Lorem ipsum Lorem ipsum
    5
    Lorem ipsum Lorem ipsum Lorem ipsum Lorem ipsum Lorem ipsum Lorem ipsum Lorem ipsum Lorem ipsum

    Lorem ipsum Lorem ipsum Lorem ipsum Lorem ipsum ipsum Lorem ipsum Lorem ipsum Lorem ipsum Lorem ipsum ipsum

    Lorem ipsum Lorem ipsum Lorem ipsum
    Matters15/30

    A hybrid plasmid pGEM-pET28 applied for heterologous expression of Neospora caninum actin

    Abstractlink

    The expression of recombinant proteins in E. coli, a valuable field of biotechnology, is the basic method for protein source in several research models. The Neospora caninum actin fragment had been unsuccessfully expressed in pET28 in E. coli. To overcome this problem, we ligated the expression region of pET28 to pGEM-T Easy Vector. The new hybrid plasmid, named pGEM-pET28, was able to express for the first time an actin fragment from N. caninum that was subsequently purified in a nickel sepharose column. The pGEM-pET28 plasmid kept the N-terminal His-Tag/thrombin/T7/Tag configuration, but it is 1.577 bp smaller than the original pET28 vector and the drug selection is made with ampicillin. The plasmid pGEM-pET28 offers a new option for gene cloning directly in the plasmid for protein expression, demonstrating that the ligation of components from distinct vectors is feasible and advantageous.

    Figurelink

    Construction of the hybrid plasmid pGEM-pET28 and actin expression.

    The expression region of pET28 (Novagen, A) was amplified by PCR and ligated to pGEM-T Easy Vector (Promega), generating the plasmid pGEM-pET28 (B). The plasmid pGEM-pET28 was applied for the recombinant expression of N. caninum actin. (C) The actin fragment from N. caninum was ligated in pGEM-pET28, electroporated in E. coli BL21 and expressed after IPTG induction. The fragment was purified in a nickel sepharose column and  analyzed by mass spectrometry. 1: Protein ladder; 2:  protein extract from E. coli induced with IPTG; 3:  protein extract from E. coli non-induced; 4: purified recombinant actin. The arrow indicates the actin fragment.

    Introductionlink

    Neospora caninum is an obligate intracellular protozoan, strongly correlated to abortion and decrease of fertility in cows, the major intermediate host[1]. The fertility losses caused by the parasite are estimated in more than a billion dollars[2], disturbing several economies. The members of this phylum are characterized by an active system of invasion. The system is composed of surface and secreted adhesive proteins, which interacts with ligands from host cells and an actin-motor of the parasite[3]. Among the methods applied for studies involving the blockage of the apicomplexan invasion system, heterologous expression in E. coli provides the primary source of potential vaccine antigens, such as AMA-1 (apical membrane antigen) and MSP2 (merozoite superficial protein) from Plasmodium falciparum[4]. This expression system is extensively applied as a source of proteins on laboratory or industrial scale[5]. The most evident features of expression in E. coli are the low cost and high yield of purified proteins, sometimes up to 50% of the cellular protein mass[6]. The induction with IPTG ( isopropyl  β-D-1-thiogalactopyranoside), based on the lactose operon[7], allows the expression of proteins after an adequate bacterial growth. Among the several options of expression, the pET plasmids (Novagen), based on pBR322[8], are one of the most popular in the research and industrial fields[9]. Several approaches based on the pET family (pET 28 and 32) and E. coli (BL21, Rosetta, Rosetta Gami) failed to express fragments of actin from N. caninum by our group. In this work, we ligated the pET28 expression region in the pGEM-T Easy Vector (Promega), generating a hybrid plasmid, named pGEM-pET28. This plasmid succeeded in expressing the actin fragment of N. caninum, representing the first description of actin from N. caninum in its recombinant form. The adaptation of plasmids for expression in E. coli is a valuable tool, which is independent of a commercial  organization, offering more options for recombinant expression.

    Objectivelink

    Use of a hybrid plasmid composed of pET28 and pGEM-T Easy for heterologous expression in E. coli.

    Results & Discussionlink

    The expression of recombinant proteins through the application of the pET28 system has been extensively employed[9]. This method is one of the most simple and low-cost procedures for obtaining proteins for diverse applications and is usually the first choice among biotechnologists[5]. This work describes a new plasmid for recombinant expression based on pET28 and IPTG induction, formed by the fusion of the pET28 expression region and the pGEM-T Easy Vector. The hybrid plasmid expressed an actin fragment of N. caninum, an apicomplexan parasite related to abortion in cattle and responsible for significant losses in the cattle industry[2]. The actin has an important role in the gliding and invasion process of apicomplexans in general[10], and this is the first description from N. caninum, a Toxoplasma gondii-related parasite. Several unsuccessful attempts were previously made by our group to get the recombinant N. caninum actin in expression p lasmids. This problem was solved with the pGEM-pET28 plasmid: the recombinant actin fragment of 22 kDa was promptly expressed in BL21 (Figure C, lane 2), compared to the non-induced control (Figure C, lane 3). The actin fragment was purified (Figure C, lane 4) and the identity was confirmed by mass spectrometry. A fragment (SYELPDGNIITVGNER) covering 16.7% of the expressed protein was identified with a significant score of 92. Rare codons compose approximately 10% of the N. caninum actin (38 rare codons of 375 total codons, according to ATGme software[11]), an important factor for inhibition of protein expression in E. coli[12]. On the other hand, the origin of replication of pGEM (pUC) present in pGEM-pET28 generates higher plasmid copies as compared to pET28, probably compensating the low expression caused by rare codons. Moreover, the reduction of the plasmid size improves transformation efficiency and stability in E. coli[13], a clear advantage of the pGEM-pET28 compared to pET28. The importance of actin in Apicomplexa has been extensively demonstrated using T. gondii and Plasmodium models[14][15]. The use of pGEM-pET28 allows future research involving actin of N. caninum, bringing further knowledge of this protein within the phylum and its role in the invasion process. Our work demonstrates that vectors for maintenance of genes such as pGEM are also able to perform the function of expression as pET28, and pGEM-pET28 represents an option for the expression of proteins from deleterious protozoans.

    Conclusionslink

    The actin fragment from N. caninum was expressed in E. coli using pGEM-pET28.

    Limitationslink

    Conventional plasmids such as pET28 and pET32 failed to express N. caninum actin. This difficulty was solved with the use of pGEM-pET28. However, the recombinant actin protein was insoluble. Therefore, the next steps should be based on the solubilization of the protein. The addition of solubility-enhancement tags (such as thioredoxin or SUMO proteins) might be considered to achieve soluble and active N. caninum actin.

    Conjectureslink

    High copies of pGEM-pET28 in bacteria probably compensate the low expression caused by rare codons present in actin. Thus, pGEM-pET28 is an interesting alternative to express proteins with considerable proportion of rare codons in E. coli.

    Methodslink

    1. Ligation of pET28 region in pGEM plasmid

    The recombinant expression region of pET28 was amplified by PCR with the primers pET28 forward (TTTCTGCAGCACCACCCTGAATTGACTCTCT) and pET28 reverse (TTTCTGCAGGGATATAGTTCCTCCTTTCAGCA) flanked by PstI restriction sites (in italic). The forward and reverse primers were localized, respectively, at 383 bases upstream of the T7 promoter and 21 bases downstream of the T7 terminator (Figure A). The pET28 fragment was ligated in the pGEM-T Easy Vector (Promega) following the manufacturer’s instructions. The pGEM-pET28 (Figure B) plasmid was cloned in E. coli Top10, extracted with mini-prep (Wizard® Plus SV Minipreps; Promega), and confirmed by sequencing.

    2. N. caninum culture

    The tachyzoite forms of N. caninum Nc-1 isolate were cultured in Vero cell cultures as previously described[16]. The purification of tachyzoites was performed by exclusion chromatography in Sephadex G-25 (PD-10 columns; GE). The recovered parasites were counted in a Neubauer chamber after adequate dilution and applied as the source for RNA extraction.

    3. RNA extraction and cDNA synthesis

    RNA from N. caninum was extracted following the Trizol protocol (Invitrogen). Freshly purified tachyzoites (1×107) were solubilized in 1 mL Trizol solution and extracted in 1 mL chloroform, followed by centrifugation at 10,000 g for 15 min. The resulting aqueous phase (200 mL) was replaced into a new tube and the RNA was precipitated with 200 mL absolute isopropanol. RNA was pelleted by centrifugation at 10,000 g for 15 min and washed with 500 mL 75% ethanol. The pellet was air-dried, diluted in 50 mL water and quantified in a 260/280 nm spectrophotometer (GeneQuant Pro; Amersham/GE). cDNA was obtained by reverse transcription following the manufacturer’s instructions (GoScript™ Reverse Transcription System kit). Briefly, 500 ng of RNA was incubated with 5 nM of poli-T primer for 1 h at 37°C. The actin fragment of N. caninum (ToxoDB data bank: NcLIV_003440) was amplified from the 604 to 932 bases with the primers forward NcActBamHI (TTTGGATCCACCACCTCCGCC) and reverse NcActHindIII (TTTAAGCTTCCAATACCCTCGT). The restriction sites BamHI and HindIII are shown in italic. The N. caninum actin fragment was cloned in pGEM-T Easy Vector and sequenced.

    4. Expression of actin fragment in pGEM-pET28 plasmid

    Both pGEM (with N. caninum actin fragment) and pGEM-pET28 plasmid were treated with BamHI and HindIII. The NcActin fragment, extracted from pGEM, was ligated in the hybrid plasmid. The ligation was electroporated in E. coli Top10, verified with EcoRI treatment, and sequenced. The pGEM-pET28/Actin was electroporated in E. coli BL21 and submitted to expression inducted by 1 mM IPTG. The bacterial pellets were sonicated with 8 M urea and the recombinant actin fragment was purified in an affinity nickel sepharose column (Ni Sepharose 6 Fast Flow; GE). The extracts and aliquots with the recombinant protein were analyzed by SDS-PAGE and stained with coomassie blue G.

    5. Mass spectrometry

    The band corresponding to the recombinant actin was excised and subjected to trypsin digestion[16]. Briefly, the sample was washed three times in 25 mM NH4HCO3 pH 8.0 in 50% acetonitrile (ACN) for 15 min each wash, dehydrated in 100% ACN, and dried in a vacuum concentrator (Labconco). The gel was resuspended in 25 ng/µL trypsin solution (Trypsin Gold; Promega), incubated for 16-24 h at 37°C, and peptides extracted with 50% ACN and 5% trifluoroacetic acid (TFA). For MS/MS, the peptide solution was diluted 1:1 in α-cyano-4-hydroxycinnamic acid (10 mg/mL in 50% ACN and 0.1% TFA) and applied in a MALDI plate. The calibrant was a polyethylene glycol (PEG) solution diluted in a matrix (1:1). The identification was performed in a matrix-assisted Laser Desorption/Ionization (MALDI TOF/TOF-Bruker). The data were searched against the N. caninum predicted protein database (www.matrixscience.com), using Mascot software version 2.3.02 (Matrix Science). The carbamidomethylation of cysteine and the oxidation of methionine were set as fixed and variable modifications, respectively.

    Funding Statementlink

    The authors would like to thank CAPES and FAPESP for the PhD fellowship to L.M.P. (2009/07713-7).

    Acknowledgementslink

    The authors would like to thank the Prof. Noberto Peporine Lopes group (Chromatography and Mass Spectrometry Facility from NPPNS-FCFRP/USP) for the technical assistance with the mass spectrometry.

    Conflict of interestlink

    The authors declare no conflicts of interest.

    Ethics Statementlink

    Not applicable.

    No fraudulence is committed in performing these experiments or during processing of the data. We understand that in the case of fraudulence, the study can be retracted by Matters.

    Referenceslink
    1. Shaapan Raafat Mohamed
      The common zoonotic protozoal diseases causing abortion
      Journal of Parasitic Diseases, 40/2015, pages 1116-1129 DOI: 10.1007/s12639-015-0661-5chrome_reader_mode
    2. Reichel Michael P., Alejandra Ayanegui-Alcérreca M., Gondim Luís F.P., Ellis John T.
      What is the global economic impact of Neospora caninum in cattle - The billion dollar question
      International Journal for Parasitology, 43/2013, pages 133-142 DOI: 10.1016/j.ijpara.2012.10.022chrome_reader_mode
    3. Bargieri Daniel, Lagal Vanessa, Andenmatten Nicole,more_horiz, Ménard Robert
      Host Cell Invasion by Apicomplexan Parasites: The Junction Conundrum
      PLoS Pathogens, 10/2014, page e1004273 DOI: 10.1371/journal.ppat.1004273chrome_reader_mode
    4. Anders Robin F., Adda Christopher G., Foley Michael, Norton Raymond S.
      Recombinant protein vaccines against the asexual blood-stages of Plasmodium falciparum
      Human Vaccines, 6/2010, pages 39-53 DOI: 10.4161/hv.6.1.10712chrome_reader_mode
    5. Kamionka Mariusz
      Engineering of Therapeutic Proteins Production in Escherichia coli
      Current Pharmaceutical Biotechnology, 12/2011, pages 268-274 DOI: 10.2174/138920111794295693chrome_reader_mode
    6. Dana M. Francis, Rebecca Page
      Strategies to Optimize Protein Expression in E. coli
      Current Protocols in Protein Science, 5/2010, pages 1-29 chrome_reader_mode
    7. Jacob François, Monod Jacques
      Genetic regulatory mechanisms in the synthesis of proteins
      Journal of Molecular Biology, 3/1961, pages 318-356 DOI: 10.1016/s0022-2836(61)80072-7chrome_reader_mode
    8. Bolivar F.
      Construction and characterization of new cloning vehicles III. Derivatives of plasmid pBR322 carrying unique Eco RI sites for selection of Eco RI generated recombinant DNA molecules
    9. Sathiamoorthy Sarmitha, Shin Jumi A.
      Boundaries of the Origin of Replication: Creation of a pET-28a-Derived Vector with p15A Copy Control Allowing Compatible Coexistence with pET Vectors
    10. Meissner Markus, Ferguson David Jp, Frischknecht Freddy
      Invasion factors of apicomplexan parasites: essential or redundant?
      Current Opinion in Microbiology, 16/2013, pages 438-444 DOI: 10.1016/j.mib.2013.05.002chrome_reader_mode
    11. Daniel Edward, Onwukwe Goodluck U., Wierenga Rik K.,more_horiz, Krause Mirja
      ATGme: Open-source web application for rare codon identification and custom DNA sequence optimization
    12. Gustafsson Claes, Govindarajan Sridhar, Minshull Jeremy
      Codon bias and heterologous protein expression
      Trends in Biotechnology, 22/2004, pages 346-353 DOI: 10.1016/j.tibtech.2004.04.006chrome_reader_mode
    13. Hanahan Douglas
      Studies on transformation of Escherichia coli with plasmids
      Journal of Molecular Biology, 166/1983, pages 557-580 DOI: 10.1016/s0022-2836(83)80284-8chrome_reader_mode
    14. Bane Kartik S., Lepper Simone, Kehrer Jessica,more_horiz, Frischknecht Friedrich
      The Actin Filament-Binding Protein Coronin Regulates Motility in Plasmodium Sporozoites
      PLOS Pathogens, 12/2016, page e1005710 DOI: 10.1371/journal.ppat.1005710chrome_reader_mode
    15. Bichet Marion, Joly Candie, Hadj Henni Ahmed,more_horiz, Tardieux Isabelle
      The toxoplasma-host cell junction is anchored to the cell cortex to sustain parasite invasive force
    16. Pollo-Oliveira Letícia, Post Harm, Acencio Marcio,more_horiz, Yatsuda Ana
      Unravelling the Neospora caninum secretome through the secreted fraction (ESA) and quantification of the discharged tachyzoite using high-resolution mass spectrometry-based proteomics
      Parasites & Vectors, 6/2013, page 335 DOI: 10.1186/1756-3305-6-335chrome_reader_mode
    Commentslink

    Create a Matters account to leave a comment.