The study of host-pathogen interactions in model organisms offers a means to characterize mechanisms and new critical innate immune genes that are conserved in higher eukaryotes. In vertebrates, leukotriene A4 hydrolase (LTA4H) is known to play a role in bacterial growth restriction. Planarian, a non-vertebrate organism, has the extraordinary ability to fight a wide spectrum of bacterial pathogens and have the faculty to regenerate an entire organism from a tissue fragment. However, the antibacterial response of the planarian remains poorly understood. We evaluated the contribution of LTA4H in the antibacterial response of the planarian, and we have observed that the silencing of the Smed-LTA4H gene by RNA interference promotes the S. aureus clearance, suggesting a role of LTA4H in the microbicidal activity of planarians.

The planarian, a non-vertebrate, is actively used to investigate developmental and regeneration processes^[1]. In addition, this platyhelminth is a model used to investigate the evolutionarily conserved mechanism of antibacterial response because of its resistance to infection^[2]. Indeed, the planarian species Schmidtea mediterranea and Dugesia japonica are able to eliminate a large spectrum of human pathogens, including Staphylococcus aureus^[2], a microbe responsible for nosocomial disease and for causing pneumonia, abscess, sepsis, toxic shock syndrome^[3]. In vertebrates, Leukotriene A4 hydrolase (LTA4H) is a ubiquitously expressed enzyme that catalyzes the final step in the synthesis of leukotriene B4 (LTB4), a potent pro-inflammatory lipid mediator derived from arachidonic acid^[4]. LTA4H controls the balance of pro-inflammatory and anti-inflammatory eicosanoids and determines the expression of tumor necrosis factor (TNF)-α. The expression of LTA4H induces the production of pro-inflammatory cytokines; in contrast, the inhibition of LTA4H reduces the LPS-induced production of pro-inflammatory cytokines, upregulates the production of the anti-inflammatory cytokine interleukin-10, and enhances bacterial invasion or bacterial susceptibility^{[5][6][7][8][9]}.

The role of LTA4H in resolving a bacterial infection in a model of resistance to bacterial infection, such as planarians, remains unknown. Therefore, we investigated the role of LTA4H in the planarian species Schmidtea mediterranea, infected with S. aureus.

First, we searched for a homologue to Homo sapiens (Hs)-LTA4H (NM_000895.2) in S. mediterranea using the transcriptome database PlanMine (http://planmine.mpi-cbg.de/planmine/begin.do). Our TBLASTN analysis, using the Hs-LTA4H (NP_000886.1) as a query  and the planarian transcriptomic data (dd_Smed_v6), identified 10 sequences producing significant alignments with Hs-LTA4H   (lcl|dd_Smed_v6_733_0_2, e-value 1e-160; lcl|dd_Smed_v6_733_0_1, e-value 3e-160; lcl|dd_Smed_v6_3027_0_1, e-value 8e-142; lcl|dd_Smed_v6_2224_0_1, e-value 2e-21; lcl|dd_Smed_v6_15623_0_1, e-value 2e-20; lcl|dd_Smed_v6_6470_0_1, e-value 7e-20; lcl|dd_Smed_v6_6958_0_1, e-value 7e-20; lcl|dd_Smed_v6_1249_0_1, e-value 2e-17; lcl|dd_Smed_v6_8086_0_1, e-value 2e-13; lcl|dd_Smed_v6_7405_0_1, e-value 6e-06). Using FGENESH+ (http://www.softberry.com/), we predicted Schmidtea mediterranea (Smed)-LTA4H, as a homologue to Hs-LTA4H. Analysis with BLASTx showed a 44% homology at the protein level (97% of cover, e-value 2e-166) for predicted Smed-LTA4H with Hs-LTA4H (Fig. 1A). Second, using quantitative real-time PCR, we evaluated the expression level of the Smed-LTA4H in worms challenged by S. aureus. Our results demonstrated that S. aureus induced the mRNA expression of the Smed-LTA4H. We observed the level of mRNA expression of the Smed-LTA4H increase transiently from a relative fold change of 1 to a maximum relative fold change of 4.5, which was reached after 12 h of challenge with S. aureus (Fig. 1B). These data suggest that Smed-LTA4H is induced in response to S. aureus infection. Next, using RNA interference, we inhibited the expression of the Smed-LTA4H in planarians, and the Smed-LTA4H (RNAi) animals were fed S. aureus. We evaluated the clearance of S. aureus at 3, 6, and 9 days post-feeding using a direct measurement of the colony-forming units (CFUs) (Fig. 1C). 2 days after infection, we observed that the S. aureus CFU count was less important in the Smed-LTA4H (RNAi) worms (1.31×10e3 S. aureus CFU/worm) than in the control Smed-eGFP (RNAi) worms (1.20×10e4 S. aureus CFU/worm). 4 days after infection, the Smed-LTA4H (RNAi) worms had fully eliminated the S. aureus, whereas in the control, eGFP (RNAi) worms, S. aureus was still detected (1.12×10e2 ± 6.44×10e1 CFU/worm). S. aureus was detected for 2 additional days in the control eGFP (RNAi) worms. The observed difference between the Smed-LTA4H (RNAi) worms and the control eGFP (RNAi) worms in the rate of S. aureus elimination was not due to differences in the level of infection at T0, as there was no significant difference in the number of S. aureus CFU/worm detected at T0 between the Smed-LTA4H (RNAi) worms and the control eGFP (RNAi) worms (1.56×10e6 ± 5.31×10e5 vs 1.35×10e6 ± 6.50×10e5, respectively) (Fig. 1D). The inhibition of Smed-LTA4H expression via RNAi increases the rate of elimination of S. aureus in planarians. It is interesting to note that S. aureus induces the expression of Smed-LTA4H, suggesting that a survival strategies of S. aureus is to induce the expression of Smed-LTA4H to decrease the rate of its elimination in planarians. However, this strategy fails, probably because of other antibacterial mechanisms engaged by planarian to fight microbes. The knock-down efficiency of Smed-LTA4H was confirmed using real time RT-qPCR. The expression of Smed-LTA4H was reduced by 80% compared to the control Smed eGFP (RNAi) worms (Fig. 1E). Taken together, these data shows that the silencing of Smed-LTA4H does not affect the capacity of planarians to ingest bacteria and promotes the capacity of planarians to eliminate S. aureus. The specificity of the RNAi against LTA4H has been controlled. Indeed, for Smed-LTA4H transcript for which the RNAi was designed, the theoretical target accuracy has been calculated. We find a number of theoretical off target equal to 0, thus a target accuracy of 100%, excluding that the observed effect was due to an off-target effect. The data from this study demonstrate that (1) S. aureus induces the expression of the Smed-LTA4H and survives up to 6 days in planarians and (2) the knock down of the Smed-LTA4H significantly increased the antimicrobial activity of planarians, and S. aureus were eliminated by 4 days after infection. To date, there is no published data on the role of the LTA4H in the antibacterial processes of non-vertebrates. Therefore, the only comparisons we can make to the results from our study on non-vertebrate are based on the findings in vertebrates. In vertebrates, the overexpression of the LTA4H is responsible for an increase in TNF-induced cell necrosis leading to bacterial death. In contrast, a reduction in the LTA4H expression leads to an increase in bacterial growth^[5][9]. In addition, other work in mammals suggest LTA4H deficiency is significantly associated with tuberculosis meningitis, lymph node tuberculosis, bone tuberculosis and other extra-pulmonary tuberculosis with the exception of pleural tuberculosis in humans^[6][4][8].Therefore in vertebrates, LTA4H deficiency likely leads to bacterial proliferation and a failure to resolve the bacterial infection due to the resultant anti-inflammatory properties, whereas overexpression of the LTA4H is associated with pro-inflammatory properties and thus leads to bacterial death. Here, we observed that LTA4H deficiency in planarians has the opposite effect compared to observations in vertebrates because LTA4H deficiency promotes the clearance of bacteria in planarians. This observed difference might be linked to the extraordinary capacity of planarians to regenerate any part of their body. In fact, it has been suggested that inhibition of the LTA4H expression by maresin-1 (MaR1) induced a faster regeneration of the planarian head^[10]. In planarians, the autophagy process is required for tissue regeneration^[11] and bacterial clearance^[2]. The invalidation of the LTA4H gene could result in an increase in autophagy and a disruption of the tissue homeostasis equilibrium (controlled via autophagy), thereby leading to an increase in the elimination of the bacteria.

We can speculate through a comparison with mammalians that LTA4H expression is associated with the anti-inflammatory profile in planarians, but this must be proven by further experiments. However, we can conclude that in this study we have shown that the silencing of the LTA4H gene in planarians enhances the capability of planarians to kill S. aureus. These results suggest that in planarians, LTA4H expression is taking part to the anti-bacterial mechanisms engaged by planarians to fight microbes.

These experiments were conducted using a non-vertebrate model that is highly resistant to infection and has the capacity to continuously regenerate. The particular biological properties of the planarians could explain the unexpected role of the LTA4H compared to other organisms. In addition, we have specifically worked with S. aureus, it could be interesting to analyze LTA4H deficient planarians challenged with other microorganisms, such as Mycobacterium tuberculosis, which are often used to study the function of the LTA4H in vertebrates.

As suggested above, it would be interesting to evaluate the contribution of autophagy in the microbicidal mechanisms mediated by LTA4H in planarians. For that, it will be important to analyze the level of the autophagy in the LTA4H knock-down planarians, the expression level of autophagy markers, such as MORN2^[2], and the planarian homologue of Hs-dap-­1^[11], and the level of apoptosis by tunnel assay. It will be also interesting to determine the cell population expressing LTA4H, as well as the co-expression of LTA4H and autophagy makers in planarians. In addition, whether the regeneration process failed or is affected by the knock down of LTA4H should be examined to explain the role of LTA4H in bacterial elimination by planarians. However, we cannot exclude a contribution of the α-toxin produced by S. aureus^[12] in our observation. It will be interesting to see if other strains of S. aureus which do not produce α-toxin, such as the S. aureus RN4220 strain, have the same effect on Smed-LTA4H expression, and the effect of the silencing of Smed-LTA4H on S. aureus RN4220 behaviors.

Planarians

Used planarians belong to the species Schmidtea mediterranea (ClW4). Planarians were maintained as previously described^[13] in autoclaved water at 20°C and fed once per week with calf liver. Animals were starved for at least 2 weeks prior to the experiments.

Bacteria

Staphylococcus aureus (ATCC25923) was grown on blood agar plates (BioMerieux SA) at 37°C.

Worm feeding with bacteria

S. mediterranea were fed with S. aureus (1×10e9 bacteria) using a protocol adapted from a dsRNA feeding method^[14] as previously described^[2]. Briefly, S. aureus were suspended in homogenized liver, mixed with ultra-low-gelling-temperature agar and red food coloring, and allowed to solidify on ice. Room temperature solidified food was fed to planarians. After 2 h (defined as day 0) of feeding, the planarians were extensively washed, and then collected or kept at 20°C in function of the experiments. Each experiment has been made in triplicate, for each experiment there were 10 worms per time point.

CFU Counting

As previously described^[2], S. mediterranea were collected and homogenized in PBS. The lysate was passed 5 times through a sterile syringe with a 29G needle to disrupt planarian tissue clumps, and CFUs were counted after plating of 10 μl of a serial dilution of planarian lysates onto blood agar plates (BioMerieux SA) followed by an incubation of 24 h at 37°C.

Gene prediction

Smed-LTA4H has been identified using PlanMine transcriptomes database (http://planmine.mpi-cbg.de). Protein sequence of the Hs-LTA4H (NP_005082.1) has been blast via blastp against planmine transcriptomes dd_Smed_v6 using default parameters (e-value 1e-5). We identified the sequences producing a significant alignment with Hs-LTA4H. The top BLAST hit was used to predict Smed-LTA4H via FGENESH+ (http://www.softberry.com/) using default parameters. The homology at the protein level between predicted Smed-LTA4H and Hs-LTA4H (NP_005082.1) was analyzed using blastx. The conservation scoring was performed by PRALINE (http://www.ibi.vu.nl/ programs/pralinewww/) using default parameters. The results are color coded for amino acid conservation and the scoring scheme works from 0, for the least conserved alignment position, to 10, for the most conserved alignment position.

Cloning

To generate the Smed-LTA4H RNAi, cDNA from S. mediterranea was amplified via PCR designed with Primer3 (http://primer3.sourceforge.net/) and containing attB recombination sequences, and then the obtained PCR product was cloned as described elsewhere^[14]. The dsRNA in silico accuracy prediction was defined as follows. Targeted transcript sequences were extracted between the 3' end of the 5’ primer and the 5' end of the 3’ primer used for cloning. The extracted sequences were then cut into 21 mers using a sliding window of 1 nucleotide. All possible RNAi sequences were then generated, and each putative RNAi sequence was aligned to the planarian transcriptome using BLAST  with a word size of 21; only perfect matches were considered. For each transcript for which an RNAi was designed, a theoretical target accuracy was calculated based on the number of RNAi sequences matching the target divided by the total number of generated RNAi sequences. Smed-LTA4H primers (left primer CTCGTTCCGGTTCTTGTCGA, right primer GCAGGCGTGTGATTTGATCG), attB recombination sequences (CATTACCATCCCG).

Delivery of dsRNAs

dsRNAs were delivered to S. mediterranea as previously described^[14]. The quality of Smed-LTA4H knock down was controlled via real-time RTqPCR as described elsewhere^[15]. Primers used for real-time RTqPCR were for Smed-LTA4H (left primer TATGCCACTACCGCGAACTG, right primer CGGGCTATCTTGGCATGGAA ). Results were normalized by the expression of the control housekeeping gene Smed-ef2^[16].

RNA extraction

Total RNA (1 animal per sample, and 3 animals per experimental time point) were extracted from planarians using the Trizol method, as recommended by the manufacturer (Invitrogen). Experiments were made in triplicates.

Statistical Analysis

The results are expressed as means ± SD and were analyzed using the nonparametric Mann-Whitney U test. Differences were considered significant at p <0.05.

Nucleotide sequence and protein sequence of predicted Smed-LTA4H

>FGENESH:[mRNA] predicted Smed-LTA4H 1854 bp ATGGCCTTATCGCTAAACGATCCTGTGTCATATGCAAATTCAGAAGACTATGTTACTGAACATTTGGATTTTGACTGGATAATAGATTTTGATAGAAAACTAATTGAAGGATCAGTAAATCTACAATTGAAAAACTTAACCAAAAAACAAGCTGACTTAAAATTAGATACGAAATATCTTGATATTAAAAAAGTGTCAGTGAAAGGAACGGAAACTAGATTTGATATTGTAGATTGTAAAATCGAAGCACTTGGATCGTGTTTAAAAATTCCAATTGGAATTTCCGATGAAAAATTTTCGGTTTGTATTCAATATGCCACTACCGCGAACTGTACAGCTCTTCAGTGGTTAATTCCGGAAGCAACTGTTGGAAAAAAACATCCCTATTTATTTAGTCAATGTCAAGCCATACACGCTAGAAGTCTTTTTCCATGCCAAGATAGCCCGTGTGTAAAATCGACTTATTCTGCAAAGGTAAAAGCTCCTAATCAATTCAATGTTTTAATGAGTGCTATTAAAAATGAAGATCCTACTAAAGAAGGAAATCATTTGATACACAAATTCGAACAGAAAGTTAATATTTCTAGCTATCTTGTTGCTATTGTATGTGGTAATTTGGCTGGAAAAAAGCTAAGTAACCGTTCAACTGTCTGGTCAGAACCGGAAATGGTGGAAAAAGCCGCTCATGAGTTTGCAGACACTGAAAACTTATTATCTATTGCTGAAAGCATATGCGGCGAGTATGTTTGGGGCATATATGACTTACTAGTATTGCCACCTTCGTTTCCATACGGGGGGATGGAAAATCCATGTCTTACATTTGTTACTCCAACGCTTTTGGTTGGGGATAAATCCCTTGTGTTTGTAGTTGCGCATGAAATCACTCATTCGTGGACTGGAAACCTAGTAACTAATAAAACATGGGAAGATTTTTGGTTAAATGAGGGTCACACTCGATATATCGAAAGATTGATAATGGAGAAGTATTATGATTCCGAACTGATAAGGCATCTGCTAATTTCTATCGGCATAGCAGAACTTCAAGAATCACTTAATGCATACGGAGAAGGTCATAAATTTAATCAACTCGTTCCGGTTCTTGTCGAATGCGATCCAGACGATTCTTTCTCACGAGTGCCCTATGAGAAAGGCTCCAATTTATTATTCCATTTAGAAAATATTTGTGGCAAAGATCAAATGTTGCGCTGGTTGAAATGCTATTTTGAGCACTACAAATATAAATCTCTTACAACTGATGAGTGGAAGGCTTTCTTTTATAAATACATGATTGATAAGGAAAACATTTCAAAAGCTAAACTTGATAATGTAGATTGGAAGAAATGGTTTTATGGAAGATGGAAAATTCCAGTTGACCACGTTCTCAAACGGGATCATGGTGATGCCAGTGAGAGACTTGCCGATAAATGGATTAATTTGAACCCAGAAATATCAGATTCCGATCAAAAGGATTTATTATTGGAATATGAATCGTTCTTACCGCATCAAAAATATTACTTTTTGCAAGTGCTCAATGATTTTAAAGAGGCAAAGTTACATTCCAAAGTTATCGAGACAATGGGTAATTTGTACCAATACACCACTAGTTCTAATAGTGAAATACTATTCGGTTGGGTAATGCTGTGCATTCGATCAAATCACACGCCTGCAATTGATCAAATATTTGACTTTCTCAATTCACAAGGCCGATTGAAATATACCAAGCCAATATATCGAAACCTTGCTAATTGGCCTAATGATCACATCAAACGATTAACTGTTAAAAATTTCCTGAAAAACGAAAATACAATGCACCCAATAACTGCAAAAAGCATCAGACTTCTATTATGCCTCTGA >FGENESH: predicted Smed-LTA4H 617 aa MALSLNDPVSYANSEDYVTEHLDFDWIIDFDRKLIEGSVNLQLKNLTKKQADLKLDTKYLDIKKVSVKGTETRFDIVDCKIEALGSCLKIPIGISDEKFSVCIQYATTANCTALQWLIPEATVGKKHPYLFSQCQAIHARSLFPCQDSPCVKSTYSAKVKAPNQFNVLMSAIKNEDPTKEGNHLIHKFEQKVNISSYLVAIVCGNLAGKKLSNRSTVWSEPEMVEKAAHEFADTENLLSIAESICGEYVWGIYDLLVLPPSFPYGGMENPCLTFVTPTLLVGDKSLVFVVAHEITHSWTGNLVTNKTWEDFWLNEGHTRYIERLIMEKYYDSELIRHLLISIGIAELQESLNAYGEGHKFNQLVPVLVECDPDDSFSRVPYEKGSNLLFHLENICGKDQMLRWLKCYFEHYKYKSLTTDEWKAFFYKYMIDKENISKAKLDNVDWKKWFYGRWKIPVDHVLKRDHGDASERLADKWINLNPEISDSDQKDLLLEYESFLPHQKYYFLQVLNDFKEAKLHSKVIETMGNLYQYTTSSNSEILFGWVMLCIRSNHTPAIDQIFDFLNSQGRLKYTKPIYRNLANWPNDHIKRLTVKNFLKNENTMHPITAKSIRLLLCL

The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest. E. Ghigo research is supported by CNRS. A. Hamada is fellows of ‘‘Infectiopole Sud’’ and of “School Leadership and Academic Affairs of Mayotte.” C. Torre is fellows of the French Ministry for Research and Technology.

We thank LL. Tsoumtsa (CNRS UMR 7278) and G. Gimenez (University of Otago, NZ) for critical comments on the manuscript.

The authors declare no conflicts of interest.

Not applicable.

No fraudulence is committed in performing these experiments or during processing of the data. We understand that in the case of fraudulence, the study can be retracted by ScienceMatters.